We believe this site might serve you best::

United States

United States

Choose language: English

Promega's Cookie Policy

Our website uses functional cookies that do not collect any personal information or track your browsing activity. When you select your country, you agree that we can place these functional cookies on your device.

pUC/M13 Sequencing Primers

Designed for Sequencing Inserts Cloned into the M13 Vectors and pUC Plasmids

  • Can sequence other lacZ-containing plasmids such as the pGEM®-Z and pGEM®-Zf Vectors

Choose a primer length and direction


Catalog number selected: Q5391

$ 91.00 Your price: Log In

Add to Helix Add to Helix Add to Helix Add to Helix
pUC/M13 Sequencing Primers
Forward 17mer/2µg
$ 91.00
Your price: Log In
Change Configuration

The pUC/M13 Primers are used to sequence inserts cloned into the M13 vectors and pUC plasmids developed by Messing. The primers are purified by gel electrophoresis or HPLC and supplied in sterile water.

Primer Sequences

  • Forward (17mer): 5´-d(GTTTTCCCAGTCACGAC)-3´
  • Reverse (17mer): 5´-d(CAGGAAACAGCTATGAC)-3´
  • Reverse (22mer): 5´-d(TCACACAGGAAACAGCTATGAC)-3´
  • Forward (24mer): 5´-d(CGCCAGGGTTTTCCCAGTCACGAC)-3´


  1. Messing, J. (1983) Meth. Enzymol. 101, 20–78.


You are viewing: 2μg Change Configuration

What's in the box?

Item Part # Size

pUC/M13 Primer, Forward (17mer)

Q539A 1 x 2μg


Choose language:

Certificate of Analysis

Search for Specific Certificate:

View more results
No results

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions



You are viewing: 2μg Change Configuration

What's in the box?

Item Part # Size

pUC/M13 Primer, Reverse (17mer)

Q540A 1 x 2μg


Choose language:

Certificate of Analysis

Search for Specific Certificate:

View more results
No results

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions



You are viewing: 2μg Change Configuration

What's in the box?

Item Part # Size

pUC/M13 Primer, Reverse (22mer)

Q542A 1 x 2μg


Choose language:

Certificate of Analysis

Search for Specific Certificate:

View more results
No results

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions



You are viewing: 2μg Change Configuration

What's in the box?

Item Part # Size

pUC/M13 Primer, Forward (24mer)

Q560A 1 x 2μg


Choose language:

Certificate of Analysis

Search for Specific Certificate:

View more results
No results

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions

Choose your country


United States
United States

Pacific Asia

Korea, Republic of
Korea, Republic of


United Kingdom
United Kingdom