We believe this site might serve you best:

United States

United States

Language: English

Promega's Cookie Policy

Our website uses functional cookies that do not collect any personal information or track your browsing activity. When you select your country, you agree that we can place these functional cookies on your device.

Our website does not fully support your browser.

We've detected that you are using an older version of Internet Explorer. Your commerce experience may be limited. Please update your browser to Internet Explorer 11 or above.

pUC/M13 Sequencing Primers

Designed for Sequencing Inserts Cloned into the M13 Vectors and pUC Plasmids

  • Sequence other lacZ-containing plasmids such as the pGEM®-Z and pGEM®-Zf Vectors
  • Supplied at a concentration of 10μg/ml
  • pUC/M13 Primer, Forward (17mer; Cat.# Q5391), is no longer available
  • pUC/M13 Primer, Reverse (22mer; Cat.# Q5421), is no longer available

Choose a primer length and direction


Catalog number selected: Q5401

$ 93.00
Your price:
Add to Cart
This product is discontinued
Add to Helix
pUC/M13 Sequencing Primers
Reverse 17mer/2µg
$ 93.00
Your price: Log in
Change Configuration

The pUC/M13 Primers are used to sequence inserts cloned into the M13 vectors and pUC plasmids developed by Messing. The primers are purified by gel electrophoresis or HPLC and supplied in sterile water.

Primer Sequences

  • Reverse (17mer): 5´-d(CAGGAAACAGCTATGAC)-3´
  • Forward (24mer): 5´-d(CGCCAGGGTTTTCCCAGTCACGAC)-3´


  1. Messing, J. (1983) Meth. Enzymol. 101, 20–78.


You are viewing: Q5401 Change Configuration

What's in the box?

Item Part # Size

pUC/M13 Primer, Reverse (17mer)

Q540A 1 × 2μg


Choose language:

Download SDSPDF (41 KB) – English (United States)

Certificate of Analysis

Search by lot number

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions



You are viewing: Q5601 Change Configuration

What's in the box?

Item Part # Size

pUC/M13 Primer, Forward (24mer)

Q560A 1 × 2μg


Choose language:

Download SDSPDF (41 KB) – English (United States)

Certificate of Analysis

Search by lot number

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions


Let's find the product that meets your needs.

Talk to a Scientist

