Promega's Cookie Policy

We use cookies and similar technologies to make our website work, run analytics, improve our website, and show you personalized content and advertising. Some of these cookies are essential for our website to work. For others, we won’t set them unless you accept them. To find out more about cookies and how to manage cookies, read our Cookie Policy.

Our website does not fully support your browser.

We've detected that you are using an older version of Internet Explorer. Your commerce experience may be limited. Please update your browser to Internet Explorer 11 or above.

pTargeT™ Sequencing Primer

Q4461_pTARGET--Sequencing-Primer--24mer--1-26_3

Designed for Sequencing Inserts Cloned into the pTargeT™ Mammalian Expression Vector

  • Hybridizes to the region of the lacZ gene at nucleotides 1367–1344 on the pTargeT™ Vector

Size

Catalog number selected: Q4461

$ 93.00
Your price:
Add to Cart
This product is discontinued
Add to Helix
pTargeT™ Sequencing Primer
2μg
$ 93.00
Your price: Log in

The pTargeT™ Sequencing Primer is used to sequence inserts cloned into the pTargeT™ Mammalian Expression Vector (Cat.# A1410) and only for this vector. The primer sequence is not a binding site for any RNA polymerases and cannot be used to generate in vitro transcripts. The primer is supplied at a concentration of 10ng/μl (1.25pmol/μl) in sterile water.

The sequence of the pTargeT™ Sequencing Primer is 5´-d(TTACGCCAAGTTATTTAGGTGACA)-3´.

Specifications

What's in the box?

Item Part # Size

pTargeT™ Sequencing Primer (24mer)

Q446A 1 × 2μg

SDS

Choose language:

Download SDSPDF (193 KB) – English (United States)

Certificate of Analysis

Search by lot number

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions

BB

Let's find the product that meets your needs.

Talk to a Scientist

Uwe

Uwe

Germany