We believe this site might serve you best:

United States

United States

Language: English

Promega's Cookie Policy

Our website uses functional cookies that do not collect any personal information or track your browsing activity. When you select your country, you agree that we can place these functional cookies on your device.

Our website does not fully support your browser.

We've detected that you are using an older version of Internet Explorer. Your commerce experience may be limited. Please update your browser to Internet Explorer 11 or above.

Use code TVECTOR20 at checkout to get 20% off pGEM®-T Vector Systems! Shop Now ›

pTargeT™ Sequencing Primer


Designed for Sequencing Inserts Cloned into the pTargeT™ Mammalian Expression Vector

  • Hybridizes to the region of the lacZ gene at nucleotides 1367–1344 on the pTargeT™ Vector


Catalog number selected: Q4461

$ 91.00
Your price:
Add to Cart
This product is discontinued
Add to Helix
pTargeT™ Sequencing Primer
$ 91.00
Your price: Log in

The pTargeT™ Sequencing Primer is used to sequence inserts cloned into the pTargeT™ Mammalian Expression Vector (Cat.# A1410) and only for this vector. The primer sequence is not a binding site for any RNA polymerases and cannot be used to generate in vitro transcripts. The primer is supplied at a concentration of 10ng/μl (1.25pmol/μl) in sterile water.

The sequence of the pTargeT™ Sequencing Primer is 5´-d(TTACGCCAAGTTATTTAGGTGACA)-3´.


What's in the box?

Item Part # Size

pTargeT™ Sequencing Primer (24mer)

Q446A 1 × 2μg


Choose language:

Download SDSPDF (195 KB) – Deutsch (Deutschland)

Certificate of Analysis

Search by lot number

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions


Let's find the product that meets your needs.

Talk to a Scientist


