We believe this site might serve you best:

United States

United States

Choose language: English

Promega's Cookie Policy

Our website uses functional cookies that do not collect any personal information or track your browsing activity. When you select your country, you agree that we can place these functional cookies on your device.

pTargeT™ Sequencing Primer

Designed for Sequencing Inserts Cloned into the pTargeT™ Mammalian Expression Vector

  • Hybridizes to the region of the lacZ gene at nucleotides 1367–1344 on the pTargeT™ Vector


Catalog number selected: Q4461

$ 89.00 Your price: Log In

Add to Helix
pTargeT™ Sequencing Primer
$ 89.00
Your price: Log In

The pTargeT™ Sequencing Primer is used to sequence inserts cloned into the pTargeT™ Mammalian Expression Vector (Cat.# A1410) and only for this vector. The primer sequence is not a binding site for any RNA polymerases and cannot be used to generate in vitro transcripts. The primer is supplied at a concentration of 10ng/μl (1.25pmol/μl) in sterile water.

The sequence of the pTargeT™ Sequencing Primer is 5´-d(TTACGCCAAGTTATTTAGGTGACA)-3´.


What's in the box?

Item Part # Size

pTargeT™ Sequencing Primer (24mer)

Q446A 1 × 2μg


Choose language:

Certificate of Analysis

Search for Specific Certificate:

View more results
View more results

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions

Choose your country


United States

Pacific Asia

Korea, Republic of


United Kingdom