Promega's Cookie Policy

We use cookies and similar technologies to make our website work, run analytics, improve our website, and show you personalized content and advertising. Some of these cookies are essential for our website to work. For others, we won’t set them unless you accept them. To find out more about cookies and how to manage cookies, read our Cookie Policy.

pTargeT™ Sequencing Primer

Q4461_pTARGET--Sequencing-Primer--24mer--1-26_3
Click here to customize this product
Click here to customize this product

Designed for Sequencing Inserts Cloned into the pTargeT™ Mammalian Expression Vector

  • Hybridizes to the region of the lacZ gene at nucleotides 1367–1344 on the pTargeT™ Vector

Size

Catalog number selected: Q4461

$ 101.00
Your price:
Add to Cart
This product is discontinued
Add to Helix
This product is available under our Early Access program - Learn More
This product is available under our Catalog (FT) program - Learn More
pTargeT™ Sequencing Primer
2μg
$ 101.00
Your price: Log in

The pTargeT™ Sequencing Primer is used to sequence inserts cloned into the pTargeT™ Mammalian Expression Vector (Cat.# A1410) and only for this vector. The primer sequence is not a binding site for any RNA polymerases and cannot be used to generate in vitro transcripts. The primer is supplied at a concentration of 10ng/μl (1.25pmol/μl) in sterile water.

The sequence of the pTargeT™ Sequencing Primer is 5´-d(TTACGCCAAGTTATTTAGGTGACA)-3´.

Specifications

What's in the box?

Item Part # Size

pTargeT™ Sequencing Primer (24mer)

Q446A 1 × 2μg

Certificate of Analysis

Search by lot number

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions

BB

Let's find the product that meets your needs.

Talk to a Scientist

Alessandro

Alessandro

Italy