pTargeT™ Sequencing Primer

Q4461_pTARGET--Sequencing-Primer--24mer--1-26_3

We are sorry, but this product is discontinued.

For more information, contact Technical Service.

2μg

Consultar Precio

This product is discontinued

This product is available under our Early Access program - Learn More

This product is available under our Catalog (FT) program - Learn More

pTargeT™ Sequencing Primer

The pTargeT™ Sequencing Primer is used to sequence inserts cloned into the pTargeT™ Mammalian Expression Vector (Cat.# A1410) and only for this vector. The primer sequence is not a binding site for any RNA polymerases and cannot be used to generate in vitro transcripts. The primer is supplied at a concentration of 10ng/μl (1.25pmol/μl) in sterile water.

The sequence of the pTargeT™ Sequencing Primer is 5´-d(TTACGCCAAGTTATTTAGGTGACA)-3´.

Contenido

Item	Part #	Presentación
pTargeT™ Sequencing Primer (24mer)	Q446A	1 × 2μg

SDS

Search for SDS

Certificado de Análisis

Search by lot number

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Condiciones de Almacenaje