|
|
|
|
What are the important design features of PCR primers used to generate a linear DNA
template for TNT® Coupled in vitro Transcription/Translation
Systems(a,b,c,d,e)?
The upstream primer needs to contain minimally (from 5´ to 3´) a T7 promoter
(5´-TAATACGACTCACTATAGGG-3´), a spacer region of 5-10 bases between the first
transcribed base and the A of the initiation codon (ATG), and sequence corresponding to
the target gene being amplified. The third G upstream from the 3´-end of the T7 promoter
corresponds to the first base transcribed by T7 RNA Polymerase
(Cat.# P2075). The
addition of five random bases immediately upstream of the T7 promoter binding site can, in
some cases, improve protein yields. In these cases, it is presumed that the additional
bases at the extreme 5´ terminus of the DNA aid in transcription initiation by the T7 RNA
Polymerase. The presence of 5-10 bases upstream of the initiation codon provides
"room" for the 43S pre-initiation complex to bind and scan for the AUG
initiation codon. In addition, the initiation codon may be placed in the context of a
Kozak consensus sequence (A/GCCATGG). The Kozak consensus sequence is based on sequences
found around the initiation codon of highly expressed genes and is believed to increase
protein yields over initiation codons found in a non-Kozak consensus sequence. Finally,
the upstream primer must have sufficient target sequence at its 3´-end to anneal to the
correct template DNA (usually ~18 bases). Therefore, the overall length of a necessary
upstream primer may be in excess of 53 bases.
Unless the target sequence being amplified contains a termination codon (TAA, TGA or TAG),
it is necessary to include one of these codon sequences in the downstream primer. This
facilitates efficient termination and generation of protein product of the correct size as
well as recycling of the ribosomal subunits for additional rounds of translation. As with
the upstream primer, it must have sufficient target sequence to anneal correctly to the
template DNA (~18 bases).
It is best for both primers to be of similar length and %GC content (if possible) in order
that they will possess similar annealing temperatures. The easiest way to increase the
size of the downstream primer is to use more target sequence at the 3´-end (e.g., 48
bases instead of 18). There are multiple ways to calculate theoretical
annealing temperatures (e.g., melting temperature, Tm) of oligonucleotide
primers.
One equation considers the concentration of monovalent cations, %GC
content and length of the oligo:
Tm =
81.5°C + 16.6°C x (log10[[Na+]+[K+]])
+ 0.41°C x (%GC) - 675/N
...where N = number of nucleotides in the primer. Note that PCR is
typically conducted in monovalent cation concentration of ~50mM.
For example, Promega's T7 Promoter Primer (Cat.# Q5021)
(TAATACGACTCACTATAGGG) has 5-T's, 7-A's, 4-C's and 4-G's (20mer, 40% GC). Thus, its
melting temperature using the equation above is:
81.5°C + 16.6°C x
(log10[0.05])
+ 0.41°C x (%GC) - 675/20
= 42.5°C
Once the Tm for each primer is known, 5°C below the lowest Tm
is a good starting point for the annealing step in PCR. If you see multiple products, try
increasing the Tm in 1°C increments until the nonspecific products disappear.
(a)U.S. Pat. No. 5,283,179,
Australian Pat. No. 649289 and other patents. Certain applications of this product may
require licenses from others.
(b)U.S. Pat. Nos. 5,492,817, 5,665,563,
Australian Pat. No. 660329 and other patents.
(c)U.S. Pat. No. 5,552,302, Australian Pat. No.
646803 and other patents.
(d)The method of recombinant expression of
Coleoptera luciferase is covered by U.S. Pat. Nos. 5,583,024, 5,674,713 and 5,700,673.
(e)U.S. Pat. Nos. 4,966,964, 5,019,556 and
5,266,687, which claim vectors encoding a portion of human placental ribonuclease
inhibitor, are exclusively licensed to Promega Corporation.
TNT is a trademark of Promega
Corporation and is registered with U.S. Patent and Trademark Office. Amplification
Assistant is a service mark of Promega Corporation. |
