Focus: Sequencing

Sequencing Primers for Flexi® Vector Inserts

When first cloning PCR-amplified inserts into the Flexi® Vector System, it is necessary to sequence the construct to confirm the presence of the desired clone. Transfer between Flexi® Vectors uses a high-fidelity method and does not require resequencing. This article lists primer sequences that can be used to sequence Flexi® Vector inserts.

By Sarah Wheeler, B.A., Ethan Strauss, Ph.D., and Trista Schagat, Ph.D.
Promega Corporation

Published in August 2008

Introduction

The Flexi® Vector System is a simple, yet powerful, directional cloning method for protein-coding sequences (1). It is based on two rare-cutting restriction enzymes, SgfI and PmeI, and provides a rapid, efficient and high-fidelity way to transfer protein-coding regions between a variety of Flexi® Vectors without the need to resequence.

When first creating a Flexi® Vector construct, the protein-coding region is amplified using primers that append SgfI and PmeI restriction sites on either end of the sequence. These restriction enzyme sites are then used to clone the PCR product into the Flexi® Vector. Even when using thermostable DNA polymerases with proofreading activity, such as Pfu DNA polymerase, it is still necessary to sequence 1–2 clones to ensure no errors were introduced during the PCR. Taq DNA polymerase is not recommended for cloning protein-coding regions due to the relatively high error rate, but if this polymerase is used, 5–6 clones will typically need to be sequenced to find a 2 kilobase insert that is error-free.

Flexi® Vector Sequencing Primers

Listed in Table 1 are the sequencing primers used by Promega scientists to confirm insert sequences in the Flexi® Vectors. Table 2 is a complete list of the Flexi® Vectors and which sequencing primers have been used to sequence inserts cloned into each vector.

Table 1. Sequencing Primers for Flexi® Vector Inserts. Listed are primer sequences used by Promega scientists to sequence Flexi® Vector clones. Forward denotes primers that anneal upstream of the cloning site. Reverse denotes primers that anneal downstream of the cloning site.
Sequencing Direction Primer Name Sequence (5′→3′) Primer Location
Forward Flexi F CGGATGGCCTTTTTGCGTTTCTA rrnB transcription terminator region
Chime F CTTACTGACATCCACTTTGCCTTTCTCT mammalian chimeric intron region
Cer F CGGTGCGTACAATTAAGGGATTATGGT cer region
HT7 F ACATCGGCCCGGGTCTGAATC N-terminal HaloTag® 7-fusion tag
GST F GCTGGCAAGCCACGTTTGGT N-terminal GST-fusion tag
ACT F ATGCCGACGCGCTAGACGATTTC N-terminal VP16-fusion tag
BIND F ACAGATAGATTGGCTTCAGTGGAG N-terminal GAL4-fusion tag
Reverse Flexi R CTTCCTTTCGGGCTTTGTTAG 5′ to T7 terminator
HT7 R GCGCTCGCCCAGGACTTC C-terminal HaloTag® 7-fusion tag
Table 2. Sequencing Primers Compatible with Flexi® Vectors. Identical primers can be used for the ampicillin resistance (A) and kanamycin resistance (K) versions of each Flexi® Vector. Primers listed refer to those defined in Table 1. The base count from the far end of the primer through the restriction site is indicated.
Forward Primer Reverse Primer
Flexi® Vector Name Cat.# (A, K) Primer Name Distance to SgfI site (bp) Primer Name Distance to PmeI or EcoICRI/PmeI chimeric site (bp)
pF1 T7 C8441, C8451 Flexi F 181 Flexi R 95
pFN2 (GST) C8461, C8471 GST F 85 Flexi R 95
pF3 WG (BYDV) L5671, L5681 Flexi F 283 Flexi R 205
pF4 CMV C8481, C8491 Chime F 108 Flexi R 95
pF5 CMV-neo C9401, C9411 Chime F 108 Flexi R 95
pFN6 (HQ) C8511, C8521 Flexi F 175 Flexi R 95
pFC7 (HQ) C8531, C8541 Flexi F 142 Flexi R 86
pF9 CMV hRluc-neo C9361, N/A Chime F 108 Flexi R 95
pFN10 (ACT) C9331, N/A ACT F 112 Flexi R 95
pFN11 (BIND) C9341, N/A BIND F 158 Flexi R 95
pFC14 (HaloTag® 7) CMV G9651, G9661 Chime F 108 HT7 R 113
pFC15 (HaloTag® 7) CMVd1 G1611, G1601 Cer F 303 HT7 R 113
pFC16 (HaloTag® 7) CMVd2 G1591, G1571 Cer F 255 HT7 R 113
pFC17 (HaloTag® 7) CMVd3 G1551, G1321 Cer F 248 HT7 R 113
pFN18 (HaloTag® 7) T7 G2751, G2681 HT7 F 142 Flexi R 95
pFN19 (HaloTag® 7) T7 SP6 G1891, G1841 HT7 F 142 Flexi R 95
pFC20 (HaloTag® 7) T7 SP6 G1681, G1691 Flexi F 152 HT7 R 113
pFN21 (HaloTag® 7) CMV G2821, G2831 HT7 F 142 Flexi R 95
pFN22 (HaloTag® 7) CMVd1 G2841, G2851 HT7 F 142 Flexi R 95
pFN23 (HaloTag® 7) CMVd2 G2861, G2871 HT7 F 142 Flexi R 95
pFN24 (HaloTag® 7) CMVd3 G2881, G2981 HT7 F 142 Flexi R 95
pF25 ICE T7 L1061, L1081 Flexi F 167 Flexi R 95

Summary

When first cloning a protein-coding region into the Flexi® Vector System, it is necessary to sequence the insert to ensure no errors were introduced during PCR. Subsequent transfers of the protein-coding region into other Flexi® Vectors use a high-fidelity transfer method, so resequencing the coding region is not necessary. The primers listed here have been used to sequence inserts in each of the indicated Flexi® Vectors.

Reference

  1. Slater, M. (2006) The Flexi® Vector Systems: The easy way to clone. Promega Notes 93, 8–10.