Versatile vector that can be used for standard cloning and in vitro transcription SP6 and T7 RNA polymerase promoters flank the multiple cloning region Multiple cloning site provides a convenient selection of restriction sites for cloning
|
|
The pSP73 Vector can be used as a standard cloning vector and also can be used for transcription of RNA in vitro The pSP73 Vector contains the SP6 and T7 RNA polymerase promoters and a unique multiple cloning region, which includes restriction sites for BglII, EcoRV, ClaI, EcoRI, SacI, KpnI, SmaI, BamHI, XbaI, SalI, AccI, PstI, SphI, HindIII, PvuII and XhoI. The pSP72 and pSP73 Vectors are essentially identical except for the orientation of the multiple cloning site region.
Visit Product Page »
|
Sequence other lacZ-containing plasmids such as the pGEM®-Z and pGEM®-Zf Vectors Supplied at a concentration of 10μg/ml pUC/M13 Primer, Forward (17mer; Cat.# Q5391), is no longer available pUC/M13 Primer, Reverse (22mer; Cat.# Q5421), is no longer available
|
|
The pUC/M13 Primers are designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. These primers also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors. The primers are purified by gel electrophoresis or HPLC. Primer Sequences: [Reverse (17mer)] 5'-d(CAGGAAACAGCTATGAC)-3', [Forward (24mer)] 5'-d(CGCCAGGGTTTTCCCAGTCACGAC)-3'.
Visit Product Page »
|