We believe this site might serve you best:

United States

United States

Language: English

Promega's Cookie Policy

Our website uses functional cookies that do not collect any personal information or track your browsing activity. When you select your country, you agree that we can place these functional cookies on your device.

Our website does not fully support your browser.

We've detected that you are using an older version of Internet Explorer. Your commerce experience may be limited. Please update your browser to Internet Explorer 11 or above.

Limited Functionality Warning

We are currently updating our network. During this time, certain functionality may be unavailable, including online orders. We apologize for any inconvenience this may cause you.

Please contact Customer Service with any questions or comments.
Phone: (608) 274-4330
Toll-Free Phone: (800) 356-9526
Email: custserv@promega.com
Hours: 7am – 6pm, CST, Monday-Friday

CloneWeaver® Workflow Purchasing Tool

Powering Your Cloning Workflow

Product selection has never been easier

Molecular Cloning is the process of producing recombinant DNA and transforming into host organisms to replicate and make more copies. Every cloning project is unique. Read More

Once you have designed the cloning scheme, gathering all of the required reagents to get you from construct to expression and analysis is not trivial. CloneWeaver helps you build a customized cloning "kit" with all of the items your cloning scheme requires. Purchase your selection instantly, save it or email it to a purchasing agent. Soon you'll have everything you require to create the construct you need.

Previous Next

Vectors: Subcloning Change

Name Description Part Number
pUC/M13 Sequencing Primers Open/Close Add
Sequence other lacZ-containing plasmids such as the pGEM®-Z and pGEM®-Zf Vectors
Supplied at a concentration of 10μg/ml
pUC/M13 Primer, Forward (17mer; Cat.# Q5391), is no longer available
pUC/M13 Primer, Reverse (22mer; Cat.# Q5421), is no longer available

The pUC/M13 Primers are designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. These primers also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors. The primers are purified by gel electrophoresis or HPLC. Primer Sequences: [Reverse (17mer)] 5'-d(CAGGAAACAGCTATGAC)-3', [Forward (24mer)] 5'-d(CGCCAGGGTTTTCCCAGTCACGAC)-3'.

Visit Product Page »
pSP73 Vector Open/Close Add
Versatile vector that can be used for standard cloning and in vitro transcription
SP6 and T7 RNA polymerase promoters flank the multiple cloning region
Multiple cloning site provides a convenient selection of restriction sites for cloning

The pSP73 Vector can be used as a standard cloning vector and also can be used for transcription of RNA in vitro The pSP73 Vector contains the SP6 and T7 RNA polymerase promoters and a unique multiple cloning region, which includes restriction sites for BglII, EcoRV, ClaI, EcoRI, SacI, KpnI, SmaI, BamHI, XbaI, SalI, AccI, PstI, SphI, HindIII, PvuII and XhoI. The pSP72 and pSP73 Vectors are essentially identical except for the orientation of the multiple cloning site region.

Visit Product Page »
pSP64 Poly(A) Vector Open/Close Add
In vitro transcription using the SP6 promoter next to the polylinker
Poly(A)+ transcripts generated by a stretch of 30 dA:dT residues inserted in the polylinker
Multiple cloning region provides a convenient selection of restriction sites for cloning

The pSP64 Poly(A) Vector can be used as a standard cloning vector and for in vitro transcription from the SP6 promoter. The pSP64 Poly(A) Vector also can be used to generate poly(A)+ transcripts in vitro. The vector has a stretch of 30 dA:dT residues inserted between the SacI and EcoRI sites. Therefore, when foreign DNA is cloned into any polylinker site other than EcoRI (HindIII, PstI, SalI, AccI, HincII, XbaI, BamHI, AvaI, SmaI or SacI), linearization of the recombinant plasmid with EcoRI allows the use of SP6 RNA polymerase in vitro to prepare RNA copies of the inserted sequences that contain a synthetic 3' poly(A) tail of 30 residues.

Visit Product Page »
pALTER-MAX Vector Open/Close Add
Protein constitutively expressed from the human cytomegalovirus (CMV) immediate-early enhancer/promoter region in a variety of cell lines
SV40 late polyadenylation signal for efficient RNA processing
Restriction sites flanking the CMV enhancer (BglII and SgfI) and the CMV promoter (SgfI and I-PpoI) mean easy replacement by alternative regulatory regions

The pALTER-MAX Vector is a 5,534bp plasmid. It contains the human cytomegalovirus (CMV) immediate-early enhancer/promoter region for strong, constitutive expression of cloned DNA inserts in a variety of mammalian cell types. The pALTER-MAX Vector as supplied is chloramphenicol-resistant and ampicillin-sensitive.

Visit Product Page »
Your Cloning Selections
None Selected
None Selected
None Selected
None Selected
None Selected
None Selected
None Selected


Your selections can be accessed anytime at the link you will receive via email:


To share your selections via email, complete the short form below: