We believe this site might serve you best:

United States

United States

Language: English

Promega's Cookie Policy

Our website uses functional cookies that do not collect any personal information or track your browsing activity. When you select your country, you agree that we can place these functional cookies on your device.

Our website does not fully support your browser.

We've detected that you are using an older version of Internet Explorer. Your commerce experience may be limited. Please update your browser to Internet Explorer 11 or above.

Limited Functionality Warning

We are currently updating our network. During this time, certain functionality may be unavailable, including online orders. We apologize for any inconvenience this may cause you.

Please contact Customer Service with any questions or comments.
Phone: (608) 274-4330
Toll-Free Phone: (800) 356-9526
Email: custserv@promega.com
Hours: 7am – 6pm, CST, Monday-Friday

GoTaq® Long PCR Master Mix for Cloning of a High-Molecular-Weight Enzyme

SEARCH ARTICLES

LabFact #1

We highly recommend the use of barrier pipette tips for assembling components for PCR or RT-PCR to prevent contamination of reactions and reagents with template DNA, RNA or primers.

  • Print
  • Email

Abstract

PCR amplification of DNA without misincorporations becomes difficult when amplifying long gene products (>4kb). Misincorporated nucleotides can have major consequences in downstream applications. For protein expression, these can include improper folding, loss of activity and change in functional properties. In this report, we amplified a 5kb kinase gene using GoTaq® Long PCR Master Mix and subsequently cloned the gene into an expression vector. The kinase was expressed in cells, isolated using HaloTag® protein purification technology and assayed for kinase activity. This study demonstrated that the GoTaq® Long PCR Master Mix can successfully amplify long gene sequences and the amplified products are suitable for downstream protein expression.

Brad Hook and Trista Schagat

Promega Corporation

Publication Date: May 2013

Introduction

DNA amplification using polymerase chain reaction (PCR) is a powerful technique for genetic analysis in a variety of applications. For some researchers, the ability to amplify longer targets opens up more possibilities to advance their research. Standard PCR using Taq DNA polymerase is limited to targets up to under 4kb in length due to the enzyme’s relatively low fidelity and inability to correct nucleotide misincorporations during strand synthesis. These misincorporated nucleotides can cause the polymerase to dissociate from the DNA strand, terminating extension and resulting in truncated products. Researchers commonly use amplified DNA and expression vectors to create clones. As a result, misincorporated nucleotides in the PCR product can have major downstream consequences on the expressed protein product, including improper folding, loss of activity and change in functional properties. Amplifying long target sequences increases the chance for misincorporations and truncated products.

GoTaq® Long PCR Master Mix is a ready-to-use solution for amplifying long PCR targets. The master mix contains everything needed to perform long PCR; just add the template and primers to amplify your target. The GoTaq® Long PCR Master Mix requires little or no reagent optimization and can amplify up to 30kb of genomic DNA and 40kb of lower-complexity targets such as plasmid and lambda DNA (1) . The GoTaq® Long PCR Master Mix uses a blend of hot-start recombinant Taq DNA polymerase and a recombinant proofreading DNA polymerase. The recombinant Taq DNA polymerase is bound by proprietary antibodies that inhibit activity at lower temperatures, allowing reactions to be set up at room temperature. Polymerase activity is restored after an initial high-temperature denaturation. In addition to Taq DNA polymerase, GoTaq® Long PCR Master Mix contains a small amount of DNA polymerase with 3´→5´ exonuclease (i.e., proofreading) activity.

In this article, we amplify a long (5kb) gene using the GoTaq® Long PCR Master Mix and clone the gene into an expression vector. Following expression, we purified the fusion protein and assayed it for activity. This project workflow, from cloned DNA gene template to expressed, purified and analyzed protein product is a common application for many laboratories (Figure 1). This study demonstrates the suitability of GoTaq® Long PCR Master Mix for amplifying a long target gene for subsequent cloning and expression.

11428MA.epsFigure 0. Overview of the workflow from amplification to analysis.

Materials

Promega Products GoTaq® Long PCR Master Mix (Cat.# M4021)
Flexi® System, Entry/Transfer (Cat.# C8640)
Wizard® SV Gel and PCR Clean-Up System (Cat.# A9281)
FuGENE® HD Transfection Reagent (Cat.# E2311)
HaloTag® TMR Ligand (Cat.# G8252)
PureYield™ Plasmid Midiprep System (Cat.# A2492)
JM109 Competent Cells (Cat.# L2001)
HaloTag® Mammalian Protein Purification System (Cat.# G6790)
HaloTag® Control Vector (Cat.# G6591)
ADP-Glo™ Kinase Assay + ROCK1 Kinase Enzyme System (Cat.# V9581)
Clone and Vector Used MRCK2 (CDC42BPA) gene (5,073bp)
FHC01284 Kazusa clone (228,500 Daltons HaloTag® fusion protein)
pFN21K HaloTag® CMV Flexi® Vector (Cat.# G2821)
Equipment and Supplies DNA Engine® thermal cycler (Bio-Rad)
LB-Kanamycin plates
SgfI and PmeI MRCK2-specific PCR primers
Agarose LE, Analytical Grade (Cat.# V3121)
HEK293 cells
SDS-PAGE gel apparatus
Typhoon® Imager

Methods

Cloning MRCK2 with GoTaq® Long PCR Master Mix and Flexi® Cloning System

GoTaq® Long PCR Master Mix amplifications were set up as described in the GoTaq® Long PCR Master Mix Technical Manual #TM359. Fifty microliter reactions were prepared using six different amounts of template: 0.25, 0.5, 1, 1.5, 2 and 2.5ng. The template was a MRCK2 clone from the Kazusa Institute (FHC01284). PCR primers were created using the Promega Flexi® Vector Primer Design tool to clone into Flexi® Vectors using the Flexi® Cloning System. Primers: Forward- 5´ TTCTGCGATCGCCATGTCTGGAGAAGTGCGTTTGAGGCAGT 3´, Reverse- 5´ GGCGGTTTAAACCGGGTCCCAG CTCCCGCGGTC 3´. PCR was performed in a Bio-Rad DNA Engine® thermal cycler using the following conditions:

Step 1 95°C for 2 minutes
Step 2 95°C for 30 seconds
Step 3 65°C for 5 minutes
Step 4 Repeat Steps 2 and 3 for 35 cycles
Step 5 72°C for 10 minutes
Step 6 4°C soak

The size of the amplified product was determined by analyzing 5µl from each sample on a 0.8% agarose gel with the BenchTop 1kb DNA Ladder and staining with ethidium bromide. The samples were purified using the Wizard® SV Gel and PCR Clean-Up System as described in the Wizard® SV Gel and PCR Clean-Up System Technical Bulletin #TB308. The concentration of DNA was determined using a NanoDrop® 1000 Spectrophotometer. Four hundred nanograms of each sample was run on a 0.8% agarose gel, and the correctly sized product was excised (Figure 2). Gel slices from all samples were combined and the DNA was purified using the Wizard® SV Gel and PCR Clean-Up System and quantitated using a NanoDrop® 1000 Spectrophotometer.

11429TA.epsFigure 0. Agarose gel of amplified MRCK2 gene.

Six different amounts of template (0.25–2.5ng) were PCR amplified, and 400ng of each product was loaded onto a 0.8% agarose gel and run at 100V for 30 minutes. Lane M, BenchTop 1kb DNA Ladder (Cat.# G7541); lane 1, amplification product from 0.25ng of template; lane 2, 0.5ng of template; lane 3, 1ng of template; lane 4, 1.5ng of template; lane 5, 2ng of template; lane 6, 2.5ng of template. The MRCK2 gene is 5,073bp.

The purified PCR product was cloned into the pFN21K HaloTag® CMV Flexi® Vector using the Flexi® Cloning System as described in the Flexi® Vector Systems Technical Manual #TM254 [Section 4, Cloning PCR Products into the Flexi® Vectors (Entry Reaction)]. Note: Because the Kazusa clone was already in a Flexi® Vector, the transfer reaction could have been used for easy cloning; however, we chose to test GoTaq® Long PCR Master Mix using the entry reaction. Clones were selected, and primers annealing to each side of the insert sites were used to sequence into the 5´ and 3´ ends of the gene. A single isolate confirmed to have been cloned in frame was transformed into JM109 Competent Cells and plated on LB-Ampicillin plates. Plasmid was purified using the PureYield™ Plasmid Midiprep System as described in the PureYield™ Plasmid Midiprep System Technical Manual #TM253.

Expression and Purification of HaloTag®-MRCK2 Fusion Protein in HEK293 cells

HEK293 cells were transfected in a T75 flask with one of three expression vectors: HaloTag® Control Vector, pFN21K HaloTag®-MRCK2 fusion construct and Kazusa clone FHC01284. For each transfection, 200µl of 100ng/µl DNA was mixed with 800µl of serum-free DMEM. Sixty microliters of FuGENE® HD Transfection Reagent was added to each DNA/serum mixture, vortexed for 5 seconds and incubated at room temperature for 15 minutes. Five hundred microliters of the FuGENE® HD Reagent/DNA mixture was added to each T75 flask. Cells were incubated at 37°C with 5% CO2. After 48 hours, the cells were washed with 1X PBS, scraped in 25ml of cold PBS and transferred to a conical tube. The collected cells were spun at 200 × g at 4°C for 5 minutes, the media was removed and the cells were stored at –80°C overnight.

The HaloTag®-MRCK2 fusion protein was purified using the HaloTag® Mammalian Protein Purification System as described in the HaloTag® Mammalian Protein Detection and Purification Systems Technical Manual #TM348. After washing the HaloLink™ Resin and before adding HaloTEV Protease, the bound protein sample was split into two: one for cleavage with HaloTEV Protease and one for on-resin enzymatic analysis (kinase assay). The final volume of purified protein was ~200µl. Ten microliters of lysate and flowthrough were labeled using the HaloTag® TMR Ligand and run on a 4–20% SDS-PAGE. The gel image was visualized using a Typhoon® scanner with TAMRA settings. Purified eluates were run on an SDS-PAGE for analysis using silver staining.

Measuring the Kinase Activity of MRCK2

Kinase assays were performed with the purified MRCK2 protein and the resin-bound MRCK2 using the ADP-Glo™ Kinase Assay + ROCK1 Kinase Enzyme System. ROCK1 was used as an experimental control and serially diluted in 1X Reaction Buffer from 50ng to 0.78ng. Purified MRCK2, MRCK2 bound to resin, HaloTag® Control eluate and HaloTag® Control protein bound to resin were serially diluted tenfold 3 times. In a white Costar® 96-well plate, the following were mixed together: 18.86µl of 1X buffer, 0.0125µl of 50µM DTT, 1µl of S6K substrate (1µg), 0.125µl of 50µM ATP and 5µl of diluted sample. After a 60-minute incubation at room temperature, 25µl of ADP-Glo™ Reagent was added to the mixture, then incubated for 40 minutes at room temperature before 50µl of Kinase Detection Reagent was added. After incubating for 30 minutes at room temperature, luminescence was detected using a GloMax®-Multi+ Detection System (Cat.# E8032). Results were background-subtracted, averaged and plotted.

Results

The MRCK2 gene was amplified from the Kazusa MRCK2 clone using GoTaq® Long PCR Master Mix, primers containing SgfI and PmeI restriction sites and varying template amounts. The amplified 5,000bp products were separated on an agarose gel, excised from the gel, purified using the Wizard® SV Gel and PCR Clean-Up System and cloned into the pFN21K HaloTag® CMV Flexi® Vector using the Flexi® Cloning System, Entry Reaction protocol. Of the ~25 E. coli colonies growing after transformation, four clones were selected, cultured overnight and plasmid DNA isolated using the PureYield™ Midiprep System. The ends of the four clones were sequenced using ABI sequencing (Beckman Coulter Genomics), resulting in exact matches to the expected pFN21K HaloTag®-MRCK2 product. One clone was selected for expression.

HEK293 cells were transfected using FuGENE® HD Transfection Reagent with one of three plasmids: HaloTag® Control Vector, pFN21K-MRCK2 HaloTag® CMV Flexi® Vector clone or the original Kazusa Institute HaloTag®-MRCK2 clone. The expressed HaloTag® protein (from the control vector) and the HaloTag®-MRCK2 fusion proteins were purified, 10µl of the lysate and the flowthrough (unbound protein) were labeled with the HaloTag® TMR Ligand and separated using SDS-PAGE (Figure 3, Panel A). The protein was imaged on the gel using the fluorescent HaloTag® TMR Ligand. All three proteins expressed at the correct sizes with ~100% binding to the HaloLink™ Resin. The washed HaloLink™ Resin was divided in two. Half of the resin was treated with HaloTEV Protease; the other half was used in a kinase assay. The purified MRCK2 eluate from the new clone and the HaloTag® Control Vector eluate were separated by SDS-PAGE and analyzed using silver-staining (Figure 3, Panel B). The MRCK2 was visible in the purified eluate but not present in the HaloTag® Control Vector eluate.

11430TA.epsFigure 0. Expression and purification of MRCK2.

Panel A. Samples labeled with HaloTag® TMR Ligand were analyzed on a 4–20% SDS-PAGE gel. Lysates contain HaloTag® fusion protein expressed in HEK293 cells. Flowthrough samples were collected after the lysates containing HaloTag® fusion proteins were bound to HaloLink™ Resin. Panel B. Purified samples were separated on a 4–20% SDS-PAGE and then silver-stained. The sample amount loaded is indicated as a percentage of the total eluate. The MRCK2 protein is 193kDa.

ROCK1 kinase and MRCK2 kinase are both serine/threonine kinases from the same family and can both phosphorylate the same substrate, SK6 (2) (3) . Promega does not currently offer a MRCK2 Kinase Enzyme System; therefore, the ROCK1 Kinase Enzyme System was used along with the ADP-Glo™ Kinase Assay to assay the MRCK2 purified from the HaloTag® expression vectors. As an experimental control, ROCK1 was titrated into the system and assayed for kinase activity, and the results were plotted (Figure 4, Panel A). The assay was linear down to 0.78ng of ROCK1. Purified and resin-bound HaloTag® and MRCK2 proteins also were assayed for kinase activity using the ROCK1 Kinase Enzyme System with ADP-Glo™ Kinase Assay (Figure 4, Panel B). Either resin or purified protein was added to the kinase reactions. The HaloTag® Control Vector expressed HaloTag® protein but did not produce kinase activity. The Kazusa MRCK2 clone and the newly created HaloTag®-MRCK2 clone produced similar kinase activity.

11431ma.epsFigure 0. Purified proteins analyzed using the ADP-Glo™ Kinase Assay + ROCK1 Kinase Enzyme System.

Bar graph showing kinase activity of HaloTag® Control and HaloTag®-MRCK2 fusion proteins purified using the HaloTag® Mammalian Protein Purification System (Cat.# G6790). The Kazusa HaloTag®-MRCK2 samples were purified from the Kazusa clone, and the cloned HaloTag®-MRCK2 samples were produced using GoTaq® Long PCR Master Mix and cloned by the Flexi® Cloning System.

Conclusion

Our work showed that GoTaq® Long PCR Master Mix successfully amplified the 5kb MRCK2 gene, and the product was able to be cloned into the pFN21K HaloTag® CMV Flexi® Vector and the protein successfully expressed and purified from mammalian cells. The purified protein was enzymatically active in a ROCK1 kinase assay, demonstrating the suitability of the GoTaq® Long PCR Master Mix for amplifying long ORFs for subsequent cloning and expression.

References

  1. Wheeler, S., Pennington, R. and Storts, D. (2001) GoTaq® Long PCR Master Mix for Reliable Amplification of Long PCR Targets. Promega Notes 67.
  2. Turri, J.S. et al. (2012) MRCKα Kinase Assay. ADP-Glo™ Kinase Assay Applications Note.
  3. Vidugiriene, J. et al. (2011) ROCK1 Kinase Assay. ADP-Glo™ Kinase Assay Applications Note.

How to Cite This Article

Hook B and Schagat T. GoTaq® Long PCR Master Mix for Cloning of a High-Molecular-Weight Enzyme. [Internet] May 2013. [cited: year, month, date]. Available from: http://www.promega.com/resources/pubhub/gotaq-long-pcr-master-mix-for-cloning-of-a-high-molecular-weight-enzyme/

Hook B and Schagat T. GoTaq® Long PCR Master Mix for Cloning of a High-Molecular-Weight Enzyme. Promega Corporation Web site. http://www.promega.com/resources/pubhub/gotaq-long-pcr-master-mix-for-cloning-of-a-high-molecular-weight-enzyme/ Updated May 2013. Accessed Month Day, Year.

Flexi, GloMax, GoTaq, HaloTag and Wizard are registered trademarks of Promega Corporation. ADP-Glo, HaloLink and PureYield are trademarks of Promega Corporation.

Costar is a registered trademark of Corning, Inc. DNA Engine is a registered trademark of Bio-Rad Laboratories, Inc. FuGENE is a registered trademark of Fugent, L.L.C., USA. NanoDrop is a registered trademark of Thermo Fisher Scientific. Typhoon is a registered trademark of GE Healthcare Bio-sciences.

Figures

11428MA.epsFigure 0. Overview of the workflow from amplification to analysis.
11429TA.epsFigure 0. Agarose gel of amplified MRCK2 gene.

Six different amounts of template (0.25–2.5ng) were PCR amplified, and 400ng of each product was loaded onto a 0.8% agarose gel and run at 100V for 30 minutes. Lane M, BenchTop 1kb DNA Ladder (Cat.# G7541); lane 1, amplification product from 0.25ng of template; lane 2, 0.5ng of template; lane 3, 1ng of template; lane 4, 1.5ng of template; lane 5, 2ng of template; lane 6, 2.5ng of template. The MRCK2 gene is 5,073bp.

11430TA.epsFigure 0. Expression and purification of MRCK2.

Panel A. Samples labeled with HaloTag® TMR Ligand were analyzed on a 4–20% SDS-PAGE gel. Lysates contain HaloTag® fusion protein expressed in HEK293 cells. Flowthrough samples were collected after the lysates containing HaloTag® fusion proteins were bound to HaloLink™ Resin. Panel B. Purified samples were separated on a 4–20% SDS-PAGE and then silver-stained. The sample amount loaded is indicated as a percentage of the total eluate. The MRCK2 protein is 193kDa.

11431ma.epsFigure 0. Purified proteins analyzed using the ADP-Glo™ Kinase Assay + ROCK1 Kinase Enzyme System.

Bar graph showing kinase activity of HaloTag® Control and HaloTag®-MRCK2 fusion proteins purified using the HaloTag® Mammalian Protein Purification System (Cat.# G6790). The Kazusa HaloTag®-MRCK2 samples were purified from the Kazusa clone, and the cloned HaloTag®-MRCK2 samples were produced using GoTaq® Long PCR Master Mix and cloned by the Flexi® Cloning System.