We believe this site might serve you best::

United States

United States

Choose language: English

Promega's Cookie Policy

Our website uses functional cookies that do not collect any personal information or track your browsing activity. When you select your country, you agree that we can place these functional cookies on your device.

RNA Polymerase Promoter Sequencing Primers

Designed for Sequencing Inserts Cloned into the pGEM®, pALTER®-MAX and pCI-neo Vectors

  • SP6 and T7 Promoter Primers are designed for sequencing inserts cloned into the pGEM® Vectors
  • SP6 Promoter Primer is designed for sequencing inserts cloned into the pALTER®-MAX and pCI-neo Vectors
  • T7 EEV Promoter Primer is used for sequencing the pALTER®-MAX, pCMVTnT™, pTnT™, phMGFP and the pCI/pSI mammalian expression vectors

Choose a primer

Size

Catalog number selected: Q5011

$ 91.00 Your price: Log In

Add to Helix
RNA Polymerase Promoter Sequencing Primers
SP6/10µg/ml
$ 91.00
Your price: Log In
Change Configuration
The primers are designed to be annealed to single-stranded DNA or, after alkaline denaturation, to double-stranded DNA. The promoter primers are purified by gel electrophoresis or HPLC. The primers are stored in sterile water.

Primer Sequences

  • SP6: 5´-d(TATTTAGGTGACACTATAG)-3´
  • T7: 5´-d(TAATACGACTCACTATAGGG)-3´
  • T7 EEV: 5´-d(AAGGCTAGAGTACTTAATACGA)-3´

Specifications

You are viewing: 2μg Change Configuration

What's in the box?

Item Part # Size

SP6 Promoter Primer

Q501A 1 x 2μg

SDS

Choose language:

Certificate of Analysis

Search for Specific Certificate:

View more results
No results
Loading…

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions

BB

Specifications

You are viewing: 2μg Change Configuration

What's in the box?

Item Part # Size

T7 Promoter Primer (20mer)

Q502A 1 x 2μg

SDS

Choose language:

Certificate of Analysis

Search for Specific Certificate:

View more results
No results
Loading…

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions

BB

Specifications

You are viewing: 2μg Change Configuration

What's in the box?

Item Part # Size

T7 EEV Promoter Primer

Q670A 1 x 2μg

SDS

Choose language:

Certificate of Analysis

Search for Specific Certificate:

View more results
No results
Loading…

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions

BB

Resources

Choose your country

Americas

Brazil
Brazil
Canada
Canada
United States
United States

Pacific Asia

Australia
Australia
India
India
Japan
Japan
Korea, Republic of
Korea, Republic of
Singapore
Singapore

Europe

Austria
Austria
Belgium
Belgium
Denmark
Denmark
Estonia
Estonia
Finland
Finland
France
France
Germany
Germany
Iceland
Iceland
Italy
Italy
Luxembourg
Luxembourg
Netherlands
Netherlands
Norway
Norway
Poland
Poland
Spain
Spain
Sweden
Sweden
Switzerland
Switzerland
United Kingdom
United Kingdom