We believe this site might serve you best:

United States

United States

Language: English

Promega's Cookie Policy

Our website uses functional cookies that do not collect any personal information or track your browsing activity. When you select your country, you agree that we can place these functional cookies on your device.

Our website does not fully support your browser.

We've detected that you are using an older version of Internet Explorer. Your commerce experience may be limited. Please update your browser to Internet Explorer 11 or above.

Get Up to $500 of Free Promega Reagents with our Back to the Bench Program. Register Now ›

Reporter Vector Sequencing Primers

Designed for Use with the pGL4 Luciferase Vectors and Other Luciferase and CAT Reporter Vectors

  • Sequence double-stranded templates using both primers
  • Sequence single-stranded templates only using only RVprimer4

Choose primer direction


Catalog number selected: E4481

$ 342.00
Your price:
Add to Cart
This product is discontinued
Add to Helix
Reporter Vector Sequencing Primers
$ 342.00
Your price: Log in
Change Configuration

The Reporter Vector (RV) Sequencing Primers are designed for use with the pGL3 and pGL4 Luciferase Vectors, Chroma-Luc™ Vectors and pCAT™3 Reporter Vectors. RVprimer3 binds upstream of the luc+, luc2 or CAT gene, and sequencing runs clockwise across the multiple cloning region. RVprimer4 binds downstream of the luc+, luc2 or CAT polyadenylation region in the Promoter and Basic Vectors and downstream of the SV40 enhancer region of the Enhancer and Control Vectors. The primers are supplied dried.

Primer Sequences

  • RVprimer3: 5´-d(CTAGCAAAATAGGCTGTCCC)-3´
  • RVprimer4: 5´-d(GACGATAGTCATGCCCCGCG)-3´


  • Determination of the exact position of generated deletions.
  • Confirmation of production of a site-specific mutation.


You are viewing: E4481 Change Configuration

What's in the box?

Item Part # Size


E448A 1 × 2μg


Choose language:

Download SDSPDF (41 KB) – English (United States)

Certificate of Analysis

Search by lot number

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions



You are viewing: E4491 Change Configuration

What's in the box?

Item Part # Size


E449A 1 × 2μg


Choose language:

Download SDSPDF (41 KB) – English (United States)

Certificate of Analysis

Search by lot number

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions


Let's find the product that meets your needs.

Talk to a Scientist

