We believe this site might serve you best::

United States

United States

Choose language: English

Promega's Cookie Policy

Our website uses functional cookies that do not collect any personal information or track your browsing activity. When you select your country, you agree that we can place these functional cookies on your device.

Reporter Vector Sequencing Primers

Designed for Use with the pGL4 Luciferase Vectors and Other Luciferase and CAT Reporter Vectors

  • Sequence double-stranded templates using both primers
  • Sequence single-stranded templates only using only RVprimer4

Choose primer direction

Size

Catalog number selected: E4481

$ 332.00 Your price: Log In

Add to Helix Add to Helix
Reporter Vector Sequencing Primers
Clockwise/2µg
$ 332.00
Your price: Log In
Change Configuration

The Reporter Vector (RV) Sequencing Primers are designed for use with the pGL3 and pGL4 Luciferase Vectors, Chroma-Luc™ Vectors and pCAT™3 Reporter Vectors. RVprimer3 binds upstream of the luc+, luc2 or CAT gene, and sequencing runs clockwise across the multiple cloning region. RVprimer4 binds downstream of the luc+, luc2 or CAT polyadenylation region in the Promoter and Basic Vectors and downstream of the SV40 enhancer region of the Enhancer and Control Vectors. The primers are supplied dried.

Primer Sequences

  • RVprimer3: 5´-d(CTAGCAAAATAGGCTGTCCC)-3´
  • RVprimer4: 5´-d(GACGATAGTCATGCCCCGCG)-3´

Applications

  • Determination of the exact position of generated deletions.
  • Confirmation of production of a site-specific mutation.

Specifications

You are viewing: 2μg Change Configuration

What's in the box?

Item Part # Size

RVprimer3

E448A 1 x 2μg

SDS

Choose language:

Certificate of Analysis

Search for Specific Certificate:

View more results
No results
Loading…

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions

BB

Specifications

You are viewing: 2μg Change Configuration

What's in the box?

Item Part # Size

RVprimer4

E449A 1 x 2μg

SDS

Choose language:

Certificate of Analysis

Search for Specific Certificate:

View more results
No results
Loading…

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions

BB

Resources

Choose your country

Americas

Brazil
Brazil
Canada
Canada
United States
United States

Pacific Asia

Australia
Australia
India
India
Japan
Japan
Korea, Republic of
Korea, Republic of
Singapore
Singapore

Europe

Austria
Austria
Belgium
Belgium
Denmark
Denmark
Estonia
Estonia
Finland
Finland
France
France
Germany
Germany
Iceland
Iceland
Italy
Italy
Luxembourg
Luxembourg
Netherlands
Netherlands
Norway
Norway
Poland
Poland
Spain
Spain
Sweden
Sweden
Switzerland
Switzerland
United Kingdom
United Kingdom