Promega's Cookie Policy

We use cookies and similar technologies to make our website work, run analytics, improve our website, and show you personalized content and advertising. Some of these cookies are essential for our website to work. For others, we won’t set them unless you accept them. To find out more about cookies and how to manage cookies, read our Cookie Policy.

Our website does not fully support your browser.

We've detected that you are using an older version of Internet Explorer. Your commerce experience may be limited. Please update your browser to Internet Explorer 11 or above.

Reporter Vector Sequencing Primers

E4481_RVprimer3-cw--20mer---2ug-304pmole_3

We are sorry, but this product is discontinued.

For more information, contact Technical Service.

Please Enquire
This product is discontinued
Reporter Vector Sequencing Primers

The Reporter Vector (RV) Sequencing Primers are designed for use with the pGL3 and pGL4 Luciferase Vectors, Chroma-Luc™ Vectors and pCAT™3 Reporter Vectors. RVprimer3 binds upstream of the luc+, luc2 or CAT gene, and sequencing runs clockwise across the multiple cloning region. RVprimer4 binds downstream of the luc+, luc2 or CAT polyadenylation region in the Promoter and Basic Vectors and downstream of the SV40 enhancer region of the Enhancer and Control Vectors. The primers are supplied dried.

Primer Sequences

  • RVprimer3: 5´-d(CTAGCAAAATAGGCTGTCCC)-3´
  • RVprimer4: 5´-d(GACGATAGTCATGCCCCGCG)-3´

Applications

  • Determination of the exact position of generated deletions.
  • Confirmation of production of a site-specific mutation.

Specifications

You are viewing: E4481 Change Configuration

What's in the box?

Item Part # Size

RVprimer3

E448A 1 × 2μg

SDS

Choose language:

Download SDSPDF (181 KB) – English (United States)

Certificate of Analysis

Search by lot number

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions

BB

Specifications

You are viewing: E4491 Change Configuration

What's in the box?

Item Part # Size

RVprimer4

E449A 1 × 2μg

SDS

Choose language:

Download SDSPDF (180 KB) – English (United States)

Certificate of Analysis

Search by lot number

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions

BB

Let's find the product that meets your needs.

Talk to a Scientist

Paraj

Paraj

US