Required:

• T7 promoter sequence (5'-TAA TAC GAC TCA CTA TAG GG-3'). Required for transcription of the DNA template.
• ATG start codon (5'-ATG-3') if not present in the sequence being amplified. Needed for translation initiation.
• Gene-specific sequence. Needed to allow priming of the target gene.

• Kozak consensus sequence (5'-CCACCATGG-3') OR Eukaryotic translation initiation sequences from sequence being amplified. Increases efficiency of translation initiation.
• 6–10 bases upstream of promoter. Improves efficiency of promoter.
• 3- to 6-base spacer between promoter sequence and Kozak sequence. Ensures transcription starts a few bases upstream of the Kozak sequence and allows better ribosome binding to RNA.

Completed Forward Primer Design:

5'-(N_6–10)TAATACGACTCACTATAGGG (N_3–6) CCACCATGG (N_17–22)-3'

• Gene-specific sequence. Needed to allow priming of the target gene.

Desirable:

• Reverse complement of stop codon (TTA, CTA or TCA) if not presentin the sequence being amplified. Terminates translation, allowing efficient release of ribosomes for further rounds of translation.
• Addition of a poly(A) tail results in greater RNA stability and higher levels of translation.

Completed Reverse Primer Design:

5'-T₃₀ stop anticodon (N_17–22)-3'

-top of page-