Interrogation Probe Design Program
for Allele Difference Analysis

The READIT® Interrogation Probe Design Program is for designing oligonucleotide probes for use in the READIT® System. The program incorporates the probe design parameters described in the Technical Manual, #TM053. Oligonucleotides suggested by this program generally have at the penultimate 3′ position the base that represents the first difference between the alleles being detected. The sequences will be of sufficient length to give a Tm of 55°C, calculated using default base stacking melting temperature calculations as described at Promega's BioMath site. The program also checks for 'snap-back' due to 3′ sequence homology to other sequence within the probe itself. When you launch the Probe Design Program it will open in a new window 800 pixels wide.  When finished with the tool, please close the window and continue from this page.

Launch Probe Design Program

Input Format & Length

To design good probes, provide 30 bases of sequence both upstream and downstream of the sequence variation of interest. If less sequence information is available, probes might not be found. Generally probes will be about 20 bases long. Only the base designations G, A, T & C (case-insensitive) are recognized by this version of the program; other characters are ignored.  Brackets "[", "]" and a slash "/" are required to designate the location of the mutation. A dash "-" should be used to designate a deletion. For example,

• A Single Nucleotide Polymorphism (SNP) could be designated as
  GCGACTGACGACTACGACGACTAGACATACGACGCATACTAC[A/C]
  CAGACTACGACTAGCATAGCAGCATCAGGACGTACAGGA
• A Single Base Deletion in the same sequence would be designated as:
  GCGACTGACGACTACGACGACTAGACATACGACGCATACTAC[A/-]
  CAGACTACGACTAGCATAGCAGCATCAGGACGTACAGGA
• A Larger Mutation within the same sequence would be designated as:
  GCGACTGACGACTACGACGACTAGACATACGACGCATACTAC[ACAGACTAG/CCGACTA]
  GCATAGCAGCATCAGGACGTACAGGA

There are some situations that may require special considerations for probe design. Click on the links below to go to explanations in the Notes section of this document.

1. The sequence near the alleles of interest is variable and thus there is more than one possible sequence being interrogated.
2. All possible probes contain self-annealing sequences.
3. All possible probes have unacceptably low annealing temperatures.
4. The first base of each allele is identical.
5. Detection of deletions of repeats or bases from homopolymeric regions.

Copying & Pasting

You can copy & paste information from other programs into the Probe Design Form. To do so, highlight the information to be transferred and select "Edit...  Copy" on the menu bar. Next, go to the Probe Design Form, click on the text box, and select "Edit... Paste" to paste the sequence into the Probe Design Form. Alternatively, you can use Control-C (Command-C on a Macintosh) to copy and Control-V to paste. Similarly, you can copy and paste sequences from the program output into another programs or forms, such as those used to order oligonucleotides from a core facility.

Confidentiality

Sequence information entered into this READIT^® Interrogation Probe Design program will not be retained by Promega Corporation. Promega will treat this information as your confidential information and will not share this information with third parties. Should you need additional information, please contact Promega's legal department at: legal@promega.com   

Notes for READIT^® Probe Design Program for Allele Difference Analysis

This software designs probes based on some well-defined rules. The T_m must be greater than 55°C. The four bases at the 3′ end must not be able to anneal anywhere within the probe. The probe must extend at least one, and not more than three, bases past the point of difference between the alleles. The base at the 3′ end of the probe should not be an A or T if there is another option. In addition, the software does not allow ambiguous bases. Because of these rules, the probe design software can not find appropriate probes for all possible sequences that might be queried. In all cases, the probes designed by the software should be checked to insure that they are reasonable for the sequences being probed. Below are some situations in which the software may not function correctly and ways to address these situations.

1. The sequence near the alleles of interest is variable and thus there is more than one possible sequence being interrogated.
   We have found that sequences of this type can be successfully interrogated with probes that incorporate the ambiguity into their sequence. That is, they are synthesized using specific degenerate bases so there will be equal incorporation of all possible bases at the variable sites that are not being interrogated. To design probes of this sort with the probe design software, enter the sequence by randomly selecting one of the possible bases at each of the ambiguous positions. The software will design a probe. Ideally, each of the possible probe sequences should be checked for appropriate annealing temperature and the possibility of self-annealing, but in practice, we have not found this to be necessary.
2. All possible probes contain self-annealing sequences.
   In this case, it may be necessary to introduce a mismatch near the 5′ end that will disrupt the self-annealing. With the mismatch near the 5′ end of the probe, the probe will still anneal to the target, but not to itself. In this situation, each probe will need to be designed by hand and carefully validated.
    
   For example the theoretical probe:
   5′ -...GGGCCCTTTAAAGGGCCC...-3′ 
    
   would form a perfect match with itself.
   5′ -...GGGCCCTTTAAAGGGCCC...-3′ 
         ||||||||||||||||||
   3′ -...CCCGGGAAATTTCCCGGG...-5′ 
    
   If the base at the 5′ end was changed to a "C", it will likely still anneal to itself, but the base at the 3′  end of this complex would not be annealed. This would eliminate the cause of high background in the READIT^® Reaction.
   5′ -...^CGGCCCTTTAAAGGGCC^C...-3′ 
          ||||||||||||||||
   3′ -..._CCCGGGAAATTTCCCGG_C...-5′ 
3. All possible probes have unacceptably low annealing temperatures.
   This will only occur if there is insufficient sequence information available. Please enter more sequence information for the probe design program.
4. The first base of each allele is identical.
   In situations where there is a single base insertion/deletion within a run of identical bases or where there is a larger insertion or translocation that produces two different sequences but that have the same terminal base, the program will not be able to determine where the sequences actually diverge. In these cases, the point of divergence designated must be different for each allele.
    
   For example, the two sequences being probed might be:
   
   5′ -...GGGGGGGGGGGGGACGGGGGGGGGGGG...-3′ 
   and
   5′ -...GGGGGGGGGGGGGACTGGGGGGGGGGGG...-3′ 
    
   To design a probe, they must be entered as: 
   
   5′ -...GGGGGGGGGGGGAC[-/T]GGGGGGGGGGGG...-3′ 
   rather than:
   5′ -...GGGGGGGGGGGG[GAC/GACT]GGGGGGGGGGGG...-3′ 
5. Detection of deletions of repeats or bases from homopolymeric regions
   Detection of deletions or insertions of repeat units or single bases within a homopolymeric stretch can be difficult. The probe design software may design probes which are identical except for the number of repeats or bases at the 3′ end. In this case, the probe to the longer allele should work well, but the probe to the shorter allele may anneal to to the shorter and longer alleles. In this situation, it may be helpful to add extra bases to the 3′ end of the shorter allele to insure that it cannot anneal to the longer allele. In cases where the repeat or homopolymeric region is too large for this strategy, it may not be possible to use the READIT^® System.
    
   For example, the two sequences being probed might be:
   
   5′ -...AAATTTCCCGGGCCCTTTGGGAAAGGGCCC...-3′ 
   and
   5′ -...AAATTTCCCGGGCCCTTTGGAAAGGGCCC...-3′ 
    
   In this case the software will suggest the probes
   CCCGGGCCCTTTGGG and
   TCCCGGGCCCTTTG-G
    
   Note that both of these probes would hybridize to the first allele. If an additional base was added to the 3′ end of the probe for the second allele to give TCCCGGGCCCTTTG-GA, this problem will be solved.