We believe this site might serve you best:

United States

English Continue

This country code will remain if no action is taken to change it.

Don't see your country?
Promega Corporation

pUC/M13 Sequencing Primers

The pUC/M13 Primers are designed for sequencing inserts cloned into the M13 vectors and pUC plasmids developed by Messing. These primers also can be used for sequencing other lacZ-containing plasmids such as the pGEM®-Z and pGEM®-Zf Vectors. The primers are purified by gel electrophoresis or HPLC.

Primer Sequences

  • Forward (17mer): 5´-d(GTTTTCCCAGTCACGAC)-3´
  • Reverse (17mer): 5´-d(CAGGAAACAGCTATGAC)-3´
  • Reverse (22mer): 5´-d(TCACACAGGAAACAGCTATGAC)-3´
  • Forward (24mer): 5´-d(CGCCAGGGTTTTCCCAGTCACGAC)-3´

Expand to Read More »

  • Prices valid for US customers only
Product Size Conc. Catalog # *List Price QTY Add to Cart

pUC/M13 Primer, Forward (17mer)

10μg/ml Q5391 $ 85.00 Add to cart

pUC/M13 Primer, Reverse (17mer)

10μg/ml Q5401 $ 85.00 Add to cart

pUC/M13 Primer, Reverse (22mer)

10μg/ml Q5421 $ 85.00 Add to cart

pUC/M13 Primer, Forward (24mer)

10μg/ml Q5601 $ 85.00 Add to cart

Storage Conditions

Store at –20°C. The primers are supplied in sterile water.

For product intended use please see Patents & Disclaimers tab.

It appears that you have Javascript disabled. Our website requires Javascript to function correctly. For the best browsing experience, please enable Javascript.

Scientists at Your Service

Scientists at Your Service

We offer a range of services to help you succeed using Promega technologies. From product training to set up of automated systems and development of custom applications—our scientific support goes beyond the basics.

Ask us! We are here to help you.