We believe this site might serve you best:

United States

English Continue

This country code will remain if no action is taken to change it.

Don't see your country?
Promega Corporation

pUC/M13 Sequencing Primers

The pUC/M13 Primers are designed for sequencing inserts cloned into the M13 vectors and pUC plasmids developed by Messing. These primers also can be used for sequencing other lacZ-containing plasmids such as the pGEM®-Z and pGEM®-Zf Vectors. The primers are purified by gel electrophoresis or HPLC.

Primer Sequences

  • Forward (17mer): 5´-d(GTTTTCCCAGTCACGAC)-3´
  • Reverse (17mer): 5´-d(CAGGAAACAGCTATGAC)-3´
  • Reverse (22mer): 5´-d(TCACACAGGAAACAGCTATGAC)-3´
  • Forward (24mer): 5´-d(CGCCAGGGTTTTCCCAGTCACGAC)-3´

Expand to Read More »

  • *Prices valid for US customers only
Product Size Conc. Catalog # *List Price QTY Add to Cart

pUC/M13 Primer, Forward (17mer)

10μg/ml Q5391 $ 91.00 Add to cart

pUC/M13 Primer, Reverse (17mer)

10μg/ml Q5401 $ 91.00 Add to cart

pUC/M13 Primer, Reverse (22mer)

10μg/ml Q5421 $ 91.00 Add to cart

pUC/M13 Primer, Forward (24mer)

10μg/ml Q5601 $ 91.00 Add to cart

Storage Conditions

Store at –20°C. The primers are supplied in sterile water.

For product intended use please see Patents & Disclaimers tab.

It appears that you have Javascript disabled. Our website requires Javascript to function correctly. For the best browsing experience, please enable Javascript.