We believe this site might serve you best:

United States

English Continue

This country code will remain if no action is taken to change it.

Don't see your country?
Promega Corporation

pTargeT™ Sequencing Primer

The pTargeT™ Sequencing Primer is designed for sequencing inserts cloned into the pTargeT™ Mammalian Expression Vector (Cat.# A1410). The sequencing primer hybridizes to the region of the lacZ gene at nucleotides 1367–1344 on the pTargeT™ Vector.

The primer can be used only for sequencing inserts cloned into the pTargeT™ Vector. The primer sequence is not a binding site for any RNA polymerases and cannot be used to generate in vitro transcripts.

The sequence of the pTargeT™ Sequencing Primer is 5´-d(TTACGCCAAGTTATTTAGGTGACA)-3´.

The primer is supplied at a concentration ...

Expand to Read More »

  • Prices valid for US customers only
Product Size Conc. Catalog # *List Price QTY Add to Cart

pTargeT™ Sequencing Primer

- Q4461 $ 86.00 Add to cart

Storage Conditions

Store at –20°C.

For product intended use please see Patents & Disclaimers tab.

You Also May Be Interested In

It appears that you have Javascript disabled. Our website requires Javascript to function correctly. For the best browsing experience, please enable Javascript.