Reagents & Solutions
800-356-9526
608-274-4330
enotes@promega.com
|
|
 |
|
Focus: RT-PCR
Using ImProm-II™ Reverse Transcription System for Coupled RT-PCR
Promega's ImProm-II™ Reverse
Transcription System (Cat.# A3800) is
suitable for coupled RT-PCR. This article demonstrates the high degree of detection
sensitivity and proportional response exhibited using the ImProm-II™ Reverse
Transcriptase in combination with Taq DNA Polymerase
for coupled RT-PCR. |
Introduction
ImProm-II™ Reverse Transcription System(*) (Cat.# A3800)
combines a newly formulated reverse transcriptase, an optimized reaction buffer and the
associated reagents qualified for efficient synthesis of first-strand cDNA. The system is
designed to be used for quantitative synthesis of high-quality cDNA in preparation for
gene-specific analysis such as by PCR(a). The
optimized ImProm-II™ Reaction Buffer enables robust activity by both ImProm-II™
Reverse Transcriptase and Promega Taq DNA Polymerase(a,*).
The buffer also combats the inhibiting effect of reverse transcriptases on thermophilic
DNA polymerases, which is often encountered in RT-PCR (1).
The ImProm-II™ Reverse Transcription System can be used for coupled RT-PCR or
uncoupled RT-PCR; therefore, the system is suitable for the approach dictated by your
experimental questions. The components of the ImProm-II™ System are provided
separately, giving the greatest flexibility in performing first-strand cDNA synthesis,
coupled or uncoupled to PCR amplification. The individual packaging also allows for better
optimization in the cDNA synthesis step (2).
In this article the ImProm-II™ System is used in combination with Taq
DNA Polymerase for single-tube, coupled RT-PCR. Methods are defined for RNA isolation,
first-strand cDNA synthesis and gene-specific amplification and analysis.
Results
As evident in Figure 1, fewer
than five copies of a transcript were detected using the ImProm-II™ Reverse
Transcription System supplemented with Taq DNA Polymerase in coupled RT-PCR.
Kanamycin Positive Control RNA (1.2kb) was titrated over 11 orders of magnitude (from
approximately 1010 to a single copy. We combined aliquots of the diluted RNA
template with gene-specific primers for kanamycin-specific RT-PCR. In parallel, we
combined aliquots of the diluted RNA template with gene-specific primers plus oligo(dT) to
demonstrate that oligo(dT) can be used for cDNA priming with no deleterious effect on the
quality or the RT-PCR.
Figure 2 shows that the
ImProm-II™ System can be used to detect a medium-abundance message (g-actin) in 1pg of total RNA when used with Taq DNA
Polymerase for coupled RT-PCR. Human Jurkat total RNA, which had been prepared using SV Total RNA Isolation System(*) (Cat.# Z3100),
was titrated over a range of approximately 100ng to 0.1pg.
Conclusions
We demonstrated the extremely sensitive detection and proportional response using the
ImProm-II™ Reverse Transcription System for coupled RT-PCR. The single-species,
polyadenylated kanamycin transcript could be amplified from fewer than five copies of
starting material, and medium-abundance g-actin message could
be detected from as little as 1pg of human Jurkat total RNA. This optimized application, a
modification of the uncoupled RT-PCR protocol provided in the ImProm-II™ System
Technical Manual (#TM236), offers a simple method for
sensitive analysis of RNA sequences.
Methods
The ImProm-II™ Reverse Transcription System
(Cat.# A3800)
and the supplied protocol (Technical Manual #TM236)
were used with the modifications detailed in this article.
1. Template Preparation: The SV Total
RNA Isolation System (Cat.# Z3100)
was used to isolate total RNA from human Jurkat cells according to the system instructions
(#TM048) (3). Kanamycin RNA (1.2kb) was used as a
single-species, poly(A)+ RNA transcript for template titrations of a single target. For
all RNA titrations, RNA was serially diluted into ice-cold, Nuclease-Free Water. For each
20µl of RT-PCR, we combined aliquots containing known amounts of diluted RNA with primers
in thin-walled, nuclease-free tubes on ice and then added 5µl of RNA plus primer mix to
each reaction. RNA-primer combinations as outlined in Table 1 were used to illustrate the
success of RT-PCR using gene-specific primers alone or in combination with oligo(dT). The
no-template, negative control reactions consisted of water and primer but no RNA. Finally,
we heated the RNA/primer mixture at 70°C for 5 minutes and immediately chilled the tubes
on ice.
Table 1 lists the RNA targets, oligonucleotide primers and expected product sizes for
these experiments.
Table 1. Target RNA and Gene-Specific Oligonucleotide Primers Used.
Target |
Primers |
Product Size |
1.2kb Kanamycin Positive
Control RNA(*)
(Cat.#
C1381) |
Kanamycin
Sense
(GCCATTCTCACCGGATTCAGTCGTC) & Antisense
(AGCCGCCGTCCCGTCAAGTCAG)
-or-
Kanamycin Sense & Antisense
plus
Oligo(dT)15 (Cat.# C1101)
|
323bp |
Human
g-Actin mRNA |
g-Actin Sense
(AAGTACCCCATTGAGCATGGC)
& Antisense
(CACAGCTTCTCCTTGATGTCGC)
-or-
g-Actin Sense & Antisense
plus
Oligo(dT)15 |
449bp |
Notes: Kanamycin Positive Control RNA: 0.1µg, 2.5fmol (~1010
copies) to 2.5ymol (~1 copy). Kanamycin Control Primers: 20pmol each. Oligo(dT)15
Primer (Cat.#
C1101): 0.5mg. Human g-Actin mRNA, medium abundance (0.4%)
(4). Human Jurkat Cell Total RNA: 100ng to 100ag. Human g-Actin
Primers: 20pmol each.
2. Coupled RT-PCR: For each RT-PCR set (20µl per reaction), we
prepared an RT-PCR mix (in 1.5ml nuclease-free tube on ice) containing components of the
ImProm-II™ Reverse Transcription System plus Promega Taq DNA Polymerase,
minus the RNA template + primers. We mixed the combination gently and kept it on ice.
Next, we transferred 15µl of RT-PCR Mix to each prepared 5µl target/primer combination
(on ice). We topped each reaction volume with nuclease-free mineral oil to prevent
evaporation. The setup is listed in Table 2.
Table 2. RT-PCR Setup.
Component |
Final
Conc. |
Volume
(µl) |
Nuclease-Free Water(*)
(Cat.# P1193) |
|
5.9 |
ImProm-II™ Reaction
5X Buffer |
1X |
4.0 |
MgCl2, 25mM(*)
(Cat.# A3511) |
2mM |
1.6 |
PCR Nucleotide Mix(*) (10mM)
(Cat.# C1141) |
0.5mM |
1.0 |
rRNasin®
Ribonuclease Inhibitor(*,**)
(Cat.# N2511) |
1u/µl |
0.5 |
ImProm-II™
Reverse Transcriptase(*) (Cat.# A3801) |
|
1.0 |
Taq DNA
Polymerase |
0.25u/µl |
1.0 |
| |
Subtotal |
15.0 |
RNA + primers |
|
5.0 |
| |
Total |
20.0 |
Notes: RNA, maximum 1µg per reaction; primers, 0.4–1µM.
We transferred tubes to a programmed, controlled temperature block for coupled reverse
transcription and amplification as follows: Annealed primer and template, 25°C for 5
minutes; first-strand extension, 42°C for 60 minutes; heat inactivation, 95°C for 5
minutes; amplification cycle, (see figure legend for each experiment) and final extension,
70°C for 5 minutes. Table 3 enumerates important observations in designing successful
coupled RT-PCR using ImProm-II™ Reverse Transcriptase and Taq
DNA Polymerase.
Table 3. Observations About Coupled RT-PCR Using the ImProm-II™ System.
Note: For additional information on optimizing first-strand synthesis,
see the Technical Manual for the ImProm-II™ Reverse Transcription System ( #TM236) (2).
References
- Chandler, D.P., Wagnon, C.A. and Bolton, H. (1998) Reverse transcriptase (RT) inhibition
of PCR at low concentrations of template and its implications for quantitative RT-PCR. Appl.
Environ. Microbiol. 64, 669-677.
ImProm-II™ Reverse Transcription System Technical
Manual #TM236, Promega Corporation.
Adams, M.D. et al. (1995) Initial assessment of human gene diversity and
expression patterns based upon 83 million nucleotides of cDNA sequence. Nature 377(Suppl),
3-174.
SV Total RNA Isolation System Technical Manual
#TM048, Promega Corporation.
RNasin is a trademark of Promega Corporation and is registered with the U.S. Patent
and Trademark Office. ImProm-II is a trademark of Promega Corporation.
GTG is a registered trademark of FMC Corporation. NuSieve is a registered trademark of
BMA, Inc.
(a)The PCR process is covered
by patents issued and applicable in certain countries. Promega does not encourage or
support the unauthorized or unlicensed use of the PCR process. Use of this product is
recommended for persons that either have a license to perform PCR or are not required to
obtain a license.
*For Laboratory Use.
**Products may be covered by pending or issued patents. Please visit our patent and trademark web page for more information.
|
|
|
 |
Figure
1. Fewer than five copies of a transcript were detected using the ImProm-II™
Reverse Transcription System... |
|
 |
Figure
2. Detection of medium-abundance message for g-actin
starting with as little as 1pg of total RNA... |
|
