Catalog  |  Cart  |  Log In

Applications | Features | Free Product | LabFacts | FAQs | Cartoons | Subscribe | Site Help | RSS

 
Reagents & Solutions
800-356-9526
608-274-4330
enotes@promega.com

 

Focus: RT-PCR

Using ImProm-II™ Reverse Transcription System for Coupled RT-PCR

Promega's ImProm-II™ Reverse Transcription System (Cat.# A3800) is suitable for coupled RT-PCR. This article demonstrates the high degree of detection sensitivity and proportional response exhibited using the ImProm-II™ Reverse Transcriptase in combination with Taq DNA Polymerase for coupled RT-PCR.

By Katharine Miller, B.S.
Promega Corporation


Introduction

ImProm-II™ Reverse Transcription System(*) (Cat.# A3800) combines a newly formulated reverse transcriptase, an optimized reaction buffer and the associated reagents qualified for efficient synthesis of first-strand cDNA. The system is designed to be used for quantitative synthesis of high-quality cDNA in preparation for gene-specific analysis such as by PCR(a). The optimized ImProm-II™ Reaction Buffer enables robust activity by both ImProm-II™ Reverse Transcriptase and Promega Taq DNA Polymerase(a,*). The buffer also combats the inhibiting effect of reverse transcriptases on thermophilic DNA polymerases, which is often encountered in RT-PCR (1).

The ImProm-II™ Reverse Transcription System can be used for coupled RT-PCR or uncoupled RT-PCR; therefore, the system is suitable for the approach dictated by your experimental questions. The components of the ImProm-II™ System are provided separately, giving the greatest flexibility in performing first-strand cDNA synthesis, coupled or uncoupled to PCR amplification. The individual packaging also allows for better optimization in the cDNA synthesis step (2).

In this article the ImProm-II™ System is used in combination with Taq DNA Polymerase for single-tube, coupled RT-PCR. Methods are defined for RNA isolation, first-strand cDNA synthesis and gene-specific amplification and analysis.

Results

As evident in Figure 1, fewer than five copies of a transcript were detected using the ImProm-II™ Reverse Transcription System supplemented with Taq DNA Polymerase in coupled RT-PCR. Kanamycin Positive Control RNA (1.2kb) was titrated over 11 orders of magnitude (from approximately 1010 to a single copy. We combined aliquots of the diluted RNA template with gene-specific primers for kanamycin-specific RT-PCR. In parallel, we combined aliquots of the diluted RNA template with gene-specific primers plus oligo(dT) to demonstrate that oligo(dT) can be used for cDNA priming with no deleterious effect on the quality or the RT-PCR.

Figure 2 shows that the ImProm-II™ System can be used to detect a medium-abundance message (g-actin) in 1pg of total RNA when used with Taq DNA Polymerase for coupled RT-PCR. Human Jurkat total RNA, which had been prepared using SV Total RNA Isolation System(*) (Cat.# Z3100), was titrated over a range of approximately 100ng to 0.1pg.

Conclusions

We demonstrated the extremely sensitive detection and proportional response using the ImProm-II™ Reverse Transcription System for coupled RT-PCR. The single-species, polyadenylated kanamycin transcript could be amplified from fewer than five copies of starting material, and medium-abundance g-actin message could be detected from as little as 1pg of human Jurkat total RNA. This optimized application, a modification of the uncoupled RT-PCR protocol provided in the ImProm-II™ System Technical Manual (#TM236), offers a simple method for sensitive analysis of RNA sequences.

Methods

The ImProm-II™ Reverse Transcription System (Cat.# A3800) and the supplied protocol (Technical Manual #TM236) were used with the modifications detailed in this article.

1. Template Preparation: The SV Total RNA Isolation System (Cat.# Z3100) was used to isolate total RNA from human Jurkat cells according to the system instructions (#TM048) (3). Kanamycin RNA (1.2kb) was used as a single-species, poly(A)+ RNA transcript for template titrations of a single target. For all RNA titrations, RNA was serially diluted into ice-cold, Nuclease-Free Water. For each 20µl of RT-PCR, we combined aliquots containing known amounts of diluted RNA with primers in thin-walled, nuclease-free tubes on ice and then added 5µl of RNA plus primer mix to each reaction. RNA-primer combinations as outlined in Table 1 were used to illustrate the success of RT-PCR using gene-specific primers alone or in combination with oligo(dT). The no-template, negative control reactions consisted of water and primer but no RNA. Finally, we heated the RNA/primer mixture at 70°C for 5 minutes and immediately chilled the tubes on ice.

Table 1 lists the RNA targets, oligonucleotide primers and expected product sizes for these experiments.

Table 1. Target RNA and Gene-Specific Oligonucleotide Primers Used.

Target

Primers

Product Size

1.2kb Kanamycin Positive Control RNA(*)
(Cat.# C1381)

Kanamycin
Sense
(GCCATTCTCACCGGATTCAGTCGTC) & Antisense
(AGCCGCCGTCCCGTCAAGTCAG)
-or-
Kanamycin Sense & Antisense
plus
Oligo(dT)15 (
Cat.# C1101)

323bp

Human
g-Actin mRNA

g-Actin Sense
(AAGTACCCCATTGAGCATGGC)
& Antisense
(CACAGCTTCTCCTTGATGTCGC)
-or-
g-Actin Sense & Antisense
plus
Oligo(dT)15

449bp

Notes: Kanamycin Positive Control RNA: 0.1µg, 2.5fmol (~1010 copies) to 2.5ymol (~1 copy). Kanamycin Control Primers: 20pmol each. Oligo(dT)15 Primer (Cat.# C1101): 0.5mg. Human g-Actin mRNA, medium abundance (0.4%) (4). Human Jurkat Cell Total RNA: 100ng to 100ag. Human g-Actin Primers: 20pmol each.

2. Coupled RT-PCR: For each RT-PCR set (20µl per reaction), we prepared an RT-PCR mix (in 1.5ml nuclease-free tube on ice) containing components of the ImProm-II™ Reverse Transcription System plus Promega Taq DNA Polymerase, minus the RNA template + primers. We mixed the combination gently and kept it on ice. Next, we transferred 15µl of RT-PCR Mix to each prepared 5µl target/primer combination (on ice). We topped each reaction volume with nuclease-free mineral oil to prevent evaporation. The setup is listed in Table 2.

Table 2. RT-PCR Setup.

Component

Final Conc.

Volume
(µl)

Nuclease-Free Water(*)
(Cat.# P1193)

 

5.9

ImProm-II™ Reaction 5X Buffer

1X

4.0

MgCl2, 25mM(*)
(Cat.# A3511)

2mM

1.6

PCR Nucleotide Mix(*) (10mM)
(Cat.# C1141)

0.5mM

1.0

rRNasin® Ribonuclease Inhibitor(*,**)
(Cat.# N2511)

1u/µl

0.5

ImProm-II™ Reverse Transcriptase(*) (Cat.# A3801)

 

1.0

Taq DNA Polymerase

0.25u/µl

1.0

 

Subtotal

15.0

RNA + primers

 

5.0

 

Total

20.0

Notes: RNA, maximum 1µg per reaction; primers, 0.4–1µM.

We transferred tubes to a programmed, controlled temperature block for coupled reverse transcription and amplification as follows: Annealed primer and template, 25°C for 5 minutes; first-strand extension, 42°C for 60 minutes; heat inactivation, 95°C for 5 minutes; amplification cycle, (see figure legend for each experiment) and final extension, 70°C for 5 minutes. Table 3 enumerates important observations in designing successful coupled RT-PCR using ImProm-II™ Reverse Transcriptase and Taq DNA Polymerase.

Table 3. Observations About Coupled RT-PCR Using the ImProm-II™ System.

  • The volume of the RT-PCR may be changed as long as the concentration of ImProm-II™ Reverse Transcriptase and Taq DNA Polymerase remain proportionally constant.

  • Do not substitute any other reaction buffer for ImProm-II™ Reaction Buffer.

  • Optimal dNTP concentration for the first-strand synthesis is 0.5mM.

  • Though the magnesium concentration range for first-strand cDNA synthesis is between 1.5-8mM, the acceptable concentration for Taq DNA Polymerase activity is more limited and should be optimized between 1.5-2.5mM for coupled RT-PCR.

  • Addition of rRNasin® Ribonuclease Inhibitor is optional but highly recommended for efficient coupled RT-PCR.

  • The primer concentrations may be optimized based on knowledge of the sequences.

  • For first-strand synthesis, the primer annealing temperatures may be altered based on Tm of the sequence.

  • Extension temperature for first-strand cDNA synthesis is optimally between 37-42°C. For templates with troublesome secondary structure, try a temperature >42°C.

  • It is critical to thermally inactivate the reverse transcriptase (at 95°C for 5 minutes) prior to initiating amplification.

Note: For additional information on optimizing first-strand synthesis, see the Technical Manual for the ImProm-II™ Reverse Transcription System (#TM236) (2).

References

  1. Chandler, D.P., Wagnon, C.A. and Bolton, H. (1998) Reverse transcriptase (RT) inhibition of PCR at low concentrations of template and its implications for quantitative RT-PCR. Appl. Environ. Microbiol. 64, 669-677.
  2. ImProm-II™ Reverse Transcription System Technical Manual #TM236, Promega Corporation.
  3. Adams, M.D. et al. (1995) Initial assessment of human gene diversity and expression patterns based upon 83 million nucleotides of cDNA sequence. Nature 377(Suppl), 3-174.
  4. SV Total RNA Isolation System Technical Manual #TM048, Promega Corporation.

 

RNasin is a trademark of Promega Corporation and is registered with the U.S. Patent and Trademark Office. ImProm-II is a trademark of Promega Corporation.

GTG is a registered trademark of FMC Corporation. NuSieve is a registered trademark of BMA, Inc.

(a)The PCR process is covered by patents issued and applicable in certain countries. Promega does not encourage or support the unauthorized or unlicensed use of the PCR process. Use of this product is recommended for persons that either have a license to perform PCR or are not required to obtain a license.

*For Laboratory Use.

**Products may be covered by pending or issued patents. Please visit our patent and trademark web page for more information.

 

 

E-mail This Page
Printable Version

 

Figure 1

Figure 1. Fewer than five copies of a transcript were detected using the ImProm-II™ Reverse Transcription System...

Figure 2

Figure 2. Detection of medium-abundance message for g-actin starting with as little as 1pg of total RNA...