|
|
|
|
Focus: In Vitro Transcription
A Simple and Efficient Method to Produce RNAs with Homogenous 3´ Ends
QuickView
|
| We show that ribose C2´-methoxy groups (-OCH3)
present at the last two nucleotides of DNA templates can dramatically improve the quality
of transcripts produced by T7 RNA polymerase. We used the RiboMAX™ Large
Scale RNA Production System-T7 (Cat.# P1300) to produce
RNAs with homogenous 3´ ends. Adaptation of this method can be used to generate RNA
transcripts of varying lengths and should allow greater ease in purification of RNAs
useful in a number of applications. Show Me the Data! |
By Cheng Kao, Ph.D.1, S.
Rüdisser2, Ph.D., and M. Zheng2, Ph.D.
1Department of Biology, Indiana University, Bloomington, IN 47405 USA; 2Department
of Chemistry, University of California, Berkeley, and Lawrence Berkeley National
Laboratory, Berkeley, CA 97420-1460 USA
Introduction
Transcription in vitro using T7 RNA polymerase is commonly used to produce RNAs for a
wide variety of applications, including structural and biochemical studies and potential
therapeutics (1-3). Despite its usefulness, a number of undesired reactions increase the
heterogeneity of transcription products and necessitate the careful purification of the
desired RNAs. A major undesired reaction is the addition of one or more nucleotides to the
3´ end of an RNA product, commonly called N+1 activity (1,2). N+1 activity can have
detrimental effects in a number of applications, such as reducing RNA synthesis yields by
viral RNA replicase (4), complicating the NMR data analysis (5) and preventing the
effective crystallization of the RNA needed for structural studies (6). We report that
modification of the last two nucleotides at the 5´ terminus of the DNA template with
ribose C2´ methoxy moieties can significantly reduce N+1 activity of T7 RNA
polymerase and, in some cases, increase the yields of RNA products.
Transcription from DNA Templates Containing Ribose C2´-Methoxy Analogs
The effectiveness of the ribose C2´-methoxy modification is illustrated by
transcription from DNA template, S5, which encodes a 22nt RNA from within the Tetrahymena
thermophila group I intron (Figure 1, Panel A). While S5 does
produce a 22nt transcript, a 23nt N+1 product is quite prominent (Figure 1,
Panel B, lane 1). Modification of the 5´ terminal template nucleotide did not alter the
ratio of the N and N+1 products (Figure 1, Panel B, lane 2). However, modification of the
two 5´ terminal nucleotides or the penultimate position alone predominantly produced the
correctly terminated 22nt transcript (Figure 1, Panel B, lanes 3 and 4). For this
transcript, the abundance of the 22nt RNA is reproducibly two-fold higher than that from
the unmodified template.
[Click on image for larger view.] |
Figure 1. DNA templates containing 5´ guanosine nucleotides
modified with ribose C2´-methoxy reduced the N+1 activity of T7 RNA polymerase. Panel A: Schematic
of the DNA templates, S5 (unmodified) and S5** (modified with two guanylates containing
ribose C2´-methoxy), used for transcription. An asterisk (*) denotes the presence of a
methoxy-modified guanylate. Gm denotes the position of modified guanylates. The sequence
in lower case is the bottom strand of the T7 promoter, while the sequence in upper case is
the template for transcription. The arrow denotes the position for the initiation of
transcription.
Panel B: Transcripts generated from various DNA templates. The RNAs were
visualized by staining with 0.02% Toluidine blue. The 22nt product and the result of N+1
activity are indicated to the right of the gel image. Panel C: NMR
spectra of the RNA produced by DNA template, S5 (upper spectrum) and S5** (lower
spectrum). The signals from 5 to 6.2ppm containing the H1´/H5 region of the RNA are
shown. NMR spectra were recorded on a Bruker AMX-600 spectrometer. All samples were
dissolved in a phosphate buffer containing 90% H2O and 10% D2O.
Spectra for the RNAs generated from S5 (2.9mM sample) and S5** (2.7mM sample) were taken
at 30°C with 16,384 complex points in 64 scans. The proton carrier frequency was set at
4.72ppm, and the maximum for excitation was set at 7.7ppm. |
To determine whether the modified template would affect the identity of the nucleotide
incorporated into the RNA, 22nt RNAs generated from unmodified S5 and modified S5**
templates were compared using nuclear magnetic resonance (NMR) spectroscopy. We examined
the signals for the protons at ribose H1´, H5, and H6 of the 3´ terminal cytidylate in
the S5 RNA. The chemical shifts of these protons will change if the transcripts have
different bases at those positions. Transcripts generated from S5 and S5** had proton
signals that are identical (Figure 1, Panel C; and data not shown),
demonstrating that modifications in S5** did not alter the sequence of the transcription
product.
Table 1. Sequences of RNA Transcribed from P1, VY, M5-56 and P5-64.
| Template |
|
Sequence (5´-->3´) |
| P1: |
|
GAUACCUUUGGAGGGCUUCGGCUCUCU |
| VY: |
|
GGCGCAGUGGGCUAGCGCCACUCAAAA
GGCCCUA |
| M5-56: |
|
GGCAGUACCAAGUCGCGAAAGCGAUGG
CCUUGCAAAGGGUA |
| P5-64: |
|
GGCAGUACCAAGUCGCGAAAGCGAUGG
CCUUGCAAAGGGUAUGGUAAUAAGCUGCC |
Several transcriptions of RNAs ranging from 27 to 64nt were examined using the modified
and unmodified DNA templates (Figure 2). Four templates that normally
generate significant amounts of the respective N+1 products (Figure 2, lanes 1, 4, 5 and
7) were found to have significantly reduced N+1 activity when modified with two 5´
terminal ribose C2´-methoxys (Figure 2, lanes 2, 3, 6 and 8). Two of the templates (P1
and VY) also produced prematurely terminated RNAs that were one
or two nucleotides less than full-length. The ribose C2´-methoxy modification did not
significantly affect the abundance of these truncated RNAs (Figure 2, lanes 1-4).
[Click on image for larger view.] |
Figure 2. Effect of ribose C2´-methoxy modifications of the
last two nucleotides of four DNA templates on N+1 activity of T7 RNA polymerase. RNAs
in denaturing polyacrylamide gels stained with Toluidine blue. Both gels contain 20%
polyacrylamide, but samples in lanes 1-4 and lanes 5-6 were subjected to electrophoresis
for 16 and 24 hours, respectively. The DNA templates used to generate the transcripts are
listed on top of the gel images, with asterisks (**) denoting modification of the
5´-terminal two nucleotides with ribose C2´-methoxys. The lengths of the transcripts
expected for P1 and VY are indicated on the left side of the
gel image, while transcripts from M5-56 and M5-64 are listed to the right. Positions of
the RNA one nucleotide longer than expected are indicated with "N+1". The
sequence of the RNA transcribed from P1 is listed in Table 1. |
Producing More Homogeneous RiboMAX™ Transcription System Products Using
Methoxy-Modified Templates
To demonstrate that the procedure is robust and works as well on a commercially
available RNA transcription system as with our own reagents, we tested normal and
methoxy-modified templates using the Promega RiboMAX™ Large
Scale RNA Production System-T7* (Cat.# P1300). Modified
(S5** and P**) and unmodifed (S5 and P) templates were transcribed for 2 hours in
parallel, and the products were resolved by denaturing polyacrylamide gel electrophoresis
(Figure 3). The S5** and P** templates, modified with two 5´-terminal
ribose C2´-methoxys, yielded greatly reduced N+1 products (compare lanes 1 and 2; 3 and
4).
[Click on image for larger view.] |
Figure 3. Transcripts produced using the RiboMAX™ Large
Scale RNA Production System-T7 (Cat.# P1300). An
asterisk (*) denotes the presence of methoxy-modified templates. The sequence for S5 is
shown in Figure 1, Panel A; the sequence for P1 is shown in Table 1. |
Transcription from dsDNA Templates
RNA less than 100nt can be transcribed from chemically synthesized DNA templates where
only the promoter sequence is double-stranded (4). However, chemical DNA synthesis is
impractical for production of longer transcripts, and the double-stranded DNA (dsDNA)
templates generated by PCR(a) are more suitable. Therefore,
we compared transcriptions from dsDNA templates with or without the ribose C2´-methoxy
modifications at the 5´-terminal two nucleotides. The results (data not shown) were
identical to those seen in Figure 1. Therefore, dsDNA amplified by PCR using modified
primers will also reduce N+1 activity.
Summary
The ability to generate more homogenous transcription products using the template
modification of a normal transcription reaction should permit more rapid RNA purification
by high-performance liquid chromatography (7). In addition, it will facilitate
interpretation of results. This modification can be incorporated during the chemical DNA
synthesis and not affect the identity of the nucleotide incorporated into the nascent RNA.
This modification of the normal T7 transcription reaction should generate RNA useful for
many applications.
Acknowledgments
This work was originally reported in Kao, C. et al. (8). Patent for
this application has been submitted by the University of California Technology Licensing
Office. We thank Dr. Ignacio Tinoco, Jr., in whose laboratory this work was performed.
Funding was provided to I.T. by the NIH (GM10840) and DOE (DE-FG03-86ER60406) and to C.K.
by the NSF (MCB9507344) and USDA (9702126).
References
- Krupp, G. (1988) RNA synthesis: strategies for the use of bacteriophage RNA polymerases.
Gene 72, 75.
- Milligan, J.F. et al. (1987) Oligoribonucleotide synthesis using T7 RNA
polymerase and synthetic DNA templates. Nucl. Acids Res. 15,
8783.
- Tuerk, C. and Gold, L. (1990) Systematic evolution of ligands by exponential enrichment:
RNA ligands to bacteriophage T4 DNA polymerase. Science 249,
505.
- Sun, J.H. et al. (1996) Initiation of (-)-strand RNA synthesis catalyzed by the
BMV RNA-dependent RNA polymerase: synthesis of oligonucleotides. Virology 226,
1.
- Wu, M. and Tinoco, I., Jr. (1998) RNA folding causes secondary structure rearrangement. Proc.
Natl. Acad. Sci. USA 95, 11555.
- Price, S.R. et al. (1995) Crystallization of RNA-protein complexes. Methods for
large-scale preparation of RNA suitable for crystallographic studies J. Mol. Biol.
249, 398.
- Shields, T.P. et al. (1999) High-performance liquid chromatography purification
of homogenous-length RNA produced by trans cleavage with a hammerhead ribozyme. RNA
5, 1259.
- Kao, C. et al. (1999) A simple and efficient method to reduce nontemplated
nucleotide addition at the 3´ terminus of RNAs transcribed by T7 RNA polymerase. RNA
5, 1268.
RiboMAX is a trademark of Promega Corporation.
*Products may be covered by pending or issued patents. Please visit
our patent and trademark web page for more information.
(a)The PCR process is covered by patents issued and
applicable in certain countries. Promega does not encourage or support the unauthorized or
unlicensed use of the PCR process. Use of this product is recommended for persons that
either have a license to perform PCR or are not required to obtain a license.
|
