BioMath Calculators

Close Tool Window

Tm Calculations for Oligos

Print Results

There are a number of different ways to calculate the melting temperature (Tm) of an oligo. All of these methods will give different results. Please note that these calculations are theoretical. Optimum Tm values must be determined empirically.

For details on each of the calculations performed below please see the notes below, "Theoretical Tm of Oligos".

Step 1. 

Enter your oligonucleotide sequence in the field below and press "Calculate." If you are using a Promega oligo, select from the drop-down menu below. 
Also, if you know that the additional parameters of the reaction vary from the default values listed below, you may change these individually (in Step 2). 

Note: Characters other than "G", "A", "T" and "C" will be ignored.)  

or  

select from the following Promega Primers

Optional Step 2. 

Combined concentration of K+ and Na+ in the reaction: mM
(Note: Promega's standard PCR* buffers contain 50mM K+.)

Salt Concentration Adjustment: Please choose the product you are using or manually set the salt concentration above. 
Set Manually 
Access RT-PCR System 
PCR Master Mix 
AccessQuick™ RT-PCR System.
GoTaq™ Reaction Buffer
Note: Monovalent cation concentration will not affect the basic Tm calculations.

Primer concentration in the reaction: nanomolar
Note: Primer concentration will only affect the base-stacking calculations.

Adjust for Mg+2 concentration?
Mg+2 concentration in the reaction: mM
Note: Promega's standard PCR buffers contain 1.5mM Mg+2. Checking this box will only affect the base stacking calculations.

The oligo has a 5´-phosphate group
Note: Checking this box will change the calculated molecular weight but will not affect the temperature calculations.

RESULTS
Sequence analyzed:
The oligo is % GC The oligo is bases long
The molecular weight of the oligo is Daltons.
The basic Tm is °C 
The salt-adjusted Tm is °C 
The base-stacking calculated Tm is °C 
The base-stacking calculations were updated in September 2000. You may find that the predicted Tm values of known sequences will change. Please see the discussion below for details. 

Thermodynamic Parameters:

ΔH kcal/mol  ΔScal/degree k mol

Theoretical Tm of Oligos

There are several formulas for calculating melting temperatures (Tm). In all cases these calculations will give you a good starting point for determining appropriate annealing temperatures for PCR, RT-PCR, hybridization and primer extension procedures. However, a precise optimum annealing temperature must be determined empirically

Basic Tm Calculations

The simplest formula is as follows (1):

Tm = 4°C  x  (number of G’s and C’s in the primer) + 2°C  x  (number of A’s and T’s in the primer)

This formula is valid for oligos <14 bases and assumes that the reaction is carried out in the presence of 50mM monovalent cations. For longer oligos, the formula below is used:

Tm =  64.9°C + 41°C x (number of G’s and C’s in the primer – 16.4)/N

Where N is the length of the primer.

For example, Promega’s T7 Promoter Primer (TAATACGACTCACTATAGGG) is a 20mer composed of 5 T’s, 7 A’s, 4 C’s, and 4 G’s. Thus, its melting temperature is calculated:

64.9°C  +  41°C  x  (8  –  16.4)/20  =  47.7°C

 

Salt-Adjusted Tm Calculations

Another commonly used formula takes into account the salt concentration of the reaction (1–4). This formula has several variations, but all of them are essentially as follows:

Tm =  81.5°C  +  16.6°C  x  (log10[Na+] + [K+])  +  0.41°C  x  (%GC)  –  675/N

Where N is the number of nucleotides in the oligo. Note that PCR is typically performed in the presence of ~50mM monovalent cations.

Using the same T7 Promoter Primer as an example in PCR with 50mM monovalent cation concentration, its Tm is calculated:

81.5°C + 16.6°C  x  (log10[0.05])  +  0.41°C x (40)  –  675/20  =  42.5°C

 

Base-Stacking Tm Calculations

The most sophisticated Tm calculations take into account the exact sequence and base stacking parameters, not just the base composition (1,5,6).

The equation used is:

ΔH kcal

°C*Mol
Tm  =  
   –  273.15°C
ΔS + R ln([primer]/2)

Where:

This equation, as implemented above, is valid if the following assumptions are met:

For a complete discussion of the parameters involved in base-stacking calculations of Tm, see references 5, 6 and 8.

Use of the base-stacking calculations yields a Tm of 56°C for Promega’s T7 Primer when magnesium contributions are taken into account (and 47°C when they are not). 

It is apparent that all three methods give similar, but different, values for primer Tm. In most cases any one of the formulas will yield an adequate approximation of the actual Tm of the oligo but for best results the optimum annealing temperature will need to be determined empirically using the theoretically calculated Tm as a starting point.

 

Molecular weight of single stranded DNA

The molecular weight of a specific segment of DNA is equal to the sum of the molecular weights of each of the nucleotides. For a know sequence, this is calculated as the sum of the molecular weights of each nucleotide monophosphate (adjusted for the phosphodiester bond)c:

Molecular weightd = (329.2 * number of G's) + (313.2 * number of A's) + (304.2 * number of T's) + (289.2 * number of C's) 
This molecular weight is adjusted by -78 for an assumed missing 5' phosphate group (PO3) which is replaced by a single hydrogen and +17 for a 3′ hydroxyl . This must be adjusted by +78 if a 5′ phosphate is present. 


Notes

(a)We have found that most melting temperature calculations do not take into account the effects of magnesium on helix stability. Therefore, most empirical guidelines used to design experiments will not apply when the magnesium effects are included. We have included the option to consider magnesium in the equation if it is desirable but have not included it in the default setting. Including magnesium will generally raise the theoretical melting temperature by about 5–8°C for oligonucleotides in a 1.5mM Mg2+ solution (8,9).

(b)The concentrations of the primer and the target sequence will change dramatically during PCR*, but generally this will not make a significant difference to the calculated Tm. A standard 50µl reaction may contain 0.1µg of human genomic DNA as a template and is 0.5µM for each primer. This reaction would be approximately 2 femtomolar (2 x 10–15M) for each single copy target. At the end of 30 cycles, this same reaction may produce about 0.5µg of a specific 1kb amplimer that gives a final concentration of 15nM. In this case the primer concentration will not change significantly and thus will remain much greater than the target concentration (6,8).

(c)The molecular weight of the each nucleotide used in calculations was decreased by 1 in Sepetember, 2003 to correct an error. 

(d)The molecular weights of dNMP's are 18 greater than those shown in this equation because dNMP's have 3′-hydroxyl groups and 5'- hydrogens that are lost during polymerization.

   

References

  1. Rychlik, W. and Rhoads, R.E. (1989) Nucl. Acids Res. 17, 8543.
  2. PCR Core Systems Technical Bulletin #TB254, Promega Corporation.
  3. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  4. Mueller, P.R. et al. (1993) In: Current Protocols in Molecular Biology 15.5, Greene Publishing Associates, Inc. and John Wiley and Sons, New York.
  5. Borer P.N. et al. (1974) J. Mol. Biol. 86, 843.
  6. SantaLucia, J. (1998) Proc. Nat. Acad. Sci. USA 95, 1460.
  7. Allawi, H.T. and SantaLucia, J. Jr. (1997) Biochemistry 36, 10581.
  8. von Ahsen N. et al. (1999) Clin. Chem. 45, 2094.
  9. Nakano S. et al. (1999) Nucl. Acids Res. 27, 2957.

The PCR process is covered by patents issued and applicable in certain countries. Promega does not encourage or support the unauthorized or unlicensed use of the PCR process. Use of this product is recommended for persons that either have a license to perform PCR or are not required to obtain a license.