ImProm-II™ Reverse Transcription System
 The ImProm-II™ Reverse Transcription System is a convenient
kit that includes a newly formulated reverse transcriptase and an
optimized set of reagents designed for efficient, robust synthesis
of first-strand cDNA in preparation for PCR amplification.
The components of the ImProm-II™ System can be used to reverse
transcribe RNA templates starting with either total RNA, poly(A)+
mRNA or synthetic transcript RNA. The optimized reaction buffer
and powerful Reverse Transcriptase provided in the ImProm-II™
Reverse Transcription System enable full-length cDNA synthesis
for the reproducible analysis of rare or long messages. These
cDNA synthesis conditions have been formulated for standalone
applications or for easy transition to gene-specific target
amplification. Volumes from 1µl to 20µl of the reverse
transcription reaction can be directly amplified using Promega
Taq DNA Polymerase in coupled (one-step) or uncoupled
(two-step) PCR reactions.
Robust and Efficient: Reverse transcribe RNA templates
up to 8.9kb.
Versatile: Incorporate standard, fluorescently labeled
and amino-allyl modified nucleotides.
Convenient and Easy-to-Use: System includes all of the reagents
necessary to quickly set up optimized reverse transcription reactions.
Scalable and Flexible: Reaction volumes of 1–20µl can be used
in subsequent PCR reactions, and the optimized buffer also allows
for coupled RT-PCR.
Figure 1A. Full-length synthesis of 1.2kb cDNA over a range of poly(A)+
transcript RNA template concentrations using the ImProm-II™ Reverse
Transcription System. High sensitivity is demonstrated by selective
amplification of
terminal 3′ cDNA sequences in two-step RT-PCR. Titrated amounts of the 1.2kb
Kanamycin Positive Control RNA (dilutions representing approximately 1010 copies
(0.01µg) to 101 copies) were combined with 0.5µg Oligo (dT)15 primer and used in
an ImProm-II™ Reverse Transcription System first-strand synthesis reaction in
the presence of 1u/µl rRNasin® Ribonuclease Inhibitor and 6mM MgCl2. The reverse
transcription reactions were incubated at 42°C for 60 minutes. After thermal
inactivation of the reverse transcriptase, each 20µl reaction was used in a
100µl PCR that included the Upstream and Downstream Control Primers provided
with the system. The cycling program was performed as described in the ImProm-II™
Reverse Transcription System Technical Manual (#TM236) except that 38 cycles
were run. Samples of each RT-PCR were analyzed for the presence of the 323bp
amplicon by electrophoresis on a 4% GTG agarose, TBE ethidium bromide gel.
Markers (M) are Promega’s 100bp DNA Ladder (Cat.# G2101).
Figure 1B. ImProm-II™ Reverse Transcription System performs for abundant
messages in low quantities of total RNA. HeLa total RNA, oligo (dT) primed cDNA
with 300bp β-actin amplification in two-step RT-PCR. (38 cycles)
Figure 2. Full-length cDNA synthesis of 8.9kb template over a range of
temperatures using the ImProm-II™ Reverse Transcription System as
demonstrated by selective amplification of terminal 3′ sequences in two-step
PCR. The indicated amounts of RNA target and 0.5µg Oligo (dT)15 Primer were used
in an ImProm-II™ Reverse Transcription System first-strand synthesis reaction in
the presence of 1u/µl rRNasin® Ribonuclease Inhibitor and 3mM MgCl2. The reverse
transcription reactions were first annealed at 25°C and then incubated at
temperatures ranging from 37–55°C for 60 minutes. After thermal inactivation of
the reverse transcriptase, each 20µl reverse transcription reaction was used in
a 100µl PCR using Adenomatous Polyposis Coli (APC) gene-specific primers and 5
units of Taq DNA Polymerase (Cat.# M1661). The APC primers, (5′–ATGGCTGCAGCTTCATATGATC–3′)
and (5′–CCACCTTGGTTCCCAGATGAC–3′), were designed to anneal with the 3′ end of
any APC cDNA that has been extended to the 5′ end of the 8.9kb message,
selectively amplifying only the terminal 940 bases of the full-length 8.9kb cDNA
sequence. A “hot start” method was used to initiate the PCR by adding 5 units of
Taq DNA Polymerase directly to the reactions after they had equilibrated at
95°C. After a 2 minute denaturation, PCR proceeded through 38 cycles (94°C for 1
minute; 60°C for
1 minute; 72°C for 3 minutes), followed by a final extension at 72°C for 5
minutes. Samples of each RT-PCR were analyzed for the presence of the 940bp
amplicon by electrophoresis on a 2% GTG agarose, TAE ethidium bromide gel.
Markers (M) are Promega’s PCR Markers (Cat.# G3161), and the marker bands
apparent are 700, 800, 900 and 1000bp.
Request a Datasheet
ImProm-II™ Reverse Transcription System
View Online Catalog Information
ImProm-II™ Reverse Transcription System
The PCR process is covered by patents issued and applicable in certain countries. Promega does not
encourage or support the unauthorized or unlicensed use of the PCR process. Use of this product is
recommended for persons that either have a license to perform PCR or are not required to obtain a license.
|
